Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35379
Trapped Gene
Ar (ENSMUSG00000046532)
Vector Insertion
Chr X: 95346674 - 95447024
Public Clones IST14783B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000467075 (ChrX:95345060..95346673 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACAACTTTCCGCTGGCTCT ChrX:95346192..95346211 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000467075 (ChrX:95345060..95346673 +)
Downstram Exon
ENSMUSE00000451969 (ChrX:95447025..95447176 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACAACTTTCCGCTGGCTCT ChrX:95346192..95346211 60.01 50 GGTCCCTGGTACTGTCCAAA ChrX:95447047..95447066 59.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467075 ChrX:95345060..95346673 TACAACTTTCCGCTGGCTCT ChrX:95346192..95346211 60.01 50

*** Putative Vector Insertion (Chr X: 95346674 - 95447024) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000451969 ChrX:95447025..95447176 GGTCCCTGGTACTGTCCAAA ChrX:95447047..95447066 59.82 55
downstream ENSMUSE00000451961 ChrX:95481928..95482044 GACGACAAGATGGGCAATTT ChrX:95482011..95482030 59.94 45
downstream ENSMUSE00000451957 ChrX:95500576..95500863 GCCAGCATTGGAGTTTTCTC ChrX:95500643..95500662 59.82 50
downstream ENSMUSE00000451953 ChrX:95506317..95506461 TACTGAATGACCGCCATCTG ChrX:95506365..95506384 59.67 50
downstream ENSMUSE00000451949 ChrX:95510215..95510345 TTGGAGCCATCCAAACTCTT ChrX:95510296..95510315 59.67 45
downstream ENSMUSE00000451944 ChrX:95511191..95511348 CTTGAGCAGGATGTGGGATT ChrX:95511308..95511327 60.07 50
downstream ENSMUSE00000654517 ChrX:95512064..95513456 TTATCCATCTGCCCTCCTTG ChrX:95512952..95512971 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGCTTCCTGGAGTCATTC ChrX:95358653..95358673 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGATCGTGACTGGGAAAAC ChrX:95442720..95442740 58.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046532