Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35385
Trapped Gene
Gm807 (ENSMUSG00000074744)
Vector Insertion
Chr 13: 99870781 - 99875932
Public Clones IST14963D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640299 (Chr13:99870661..99870780 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGGGATGTGGAGTTCTTT Chr13:99870760..99870779 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640299 (Chr13:99870661..99870780 +)
Downstram Exon
ENSMUSE00000640298 (Chr13:99875933..99877535 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGGGATGTGGAGTTCTTT Chr13:99870760..99870779 59.97 50 CCCATGATCTAAGCCAAGGA Chr13:99876054..99876073 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640299 Chr13:99870661..99870780 CACGGGATGTGGAGTTCTTT Chr13:99870760..99870779 59.97 50

*** Putative Vector Insertion (Chr 13: 99870781 - 99875932) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640298 Chr13:99875933..99877535 CCCATGATCTAAGCCAAGGA Chr13:99876054..99876073 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:99870832..99870852 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACGGGATGTGGAGTTCTT Chr13:99873760..99873780 62.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074744