Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35386
Trapped Gene
Tmem33 (ENSMUSG00000037720)
Vector Insertion
Chr 5: 67652273 - 67654968
Public Clones IST14805E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719173 (Chr5:67652044..67652272 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCTTCTTTGCTGTTGCAG Chr5:67652183..67652202 58.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719173 (Chr5:67652044..67652272 +)
Downstram Exon
ENSMUSE00000251912 (Chr5:67654969..67655063 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCTTCTTTGCTGTTGCAG Chr5:67652183..67652202 58.95 50 ACGAACAGAGCGGAGCAATA Chr5:67655051..67655070 60.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715791 Chr5:67651891..67652045 CTGACTCACGTGGAAACGAA Chr5:67651896..67651915 59.87 50
upstream ENSMUSE00000720733 Chr5:67651891..67652045 CTGACTCACGTGGAAACGAA Chr5:67651896..67651915 59.87 50
upstream ENSMUSE00000712438 Chr5:67651936..67652045 CCTTCGCTTGGGTCTTTCTA Chr5:67651992..67652011 59.45 50
upstream ENSMUSE00000719173 Chr5:67652044..67652272 GCTCTTCTTTGCTGTTGCAG Chr5:67652183..67652202 58.95 50
upstream ENSMUSE00000251916 Chr5:67652203..67652272 No primer for this exon
upstream ENSMUSE00000696678 Chr5:67652203..67652272 No primer for this exon
upstream ENSMUSE00000712287 Chr5:67652203..67652272 No primer for this exon

*** Putative Vector Insertion (Chr 5: 67652273 - 67654968) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251912 Chr5:67654969..67655063 ACGAACAGAGCGGAGCAATA Chr5:67655051..67655070 60.93 50
downstream ENSMUSE00000251894 Chr5:67655509..67655696 AAGCACGCTGGTAAAAGCTC Chr5:67655546..67655565 59.66 50
downstream ENSMUSE00000708282 Chr5:67655509..67655851 AAGCACGCTGGTAAAAGCTC Chr5:67655546..67655565 59.66 50
downstream ENSMUSE00000251889 Chr5:67658541..67658608 TAGTGTATGTGGCAGCATGGA Chr5:67658596..67658616 60.15 47.62
downstream ENSMUSE00000251880 Chr5:67659750..67659883 No primer for this exon
downstream ENSMUSE00000251872 Chr5:67675379..67675462 AGGCTGGAGCAAACTTCCTT Chr5:67675406..67675425 60.38 50
downstream ENSMUSE00000435322 Chr5:67677335..67682700 TGCTCGTCCACTCTATGCAC Chr5:67679758..67679777 60.02 55
downstream ENSMUSE00000696664 Chr5:67677335..67677455 GCTGATAAAGGCGATGCTCT Chr5:67677443..67677462 59.58 50
downstream ENSMUSE00000721202 Chr5:67677335..67679249 AATGATTACATGGCCCCAAA Chr5:67678114..67678133 60.02 40
downstream ENSMUSE00000696662 Chr5:67678249..67682700 TGCTCGTCCACTCTATGCAC Chr5:67679758..67679777 60.02 55
downstream ENSMUSE00000713636 Chr5:67678249..67679485 TTCCCCATGAGTTGCCTTAC Chr5:67678439..67678458 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:67652324..67652344 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGGCGAGGACGTGACTG Chr5:67652312..67652332 63.78 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037720