Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35404
Trapped Gene
Ifngr1 (ENSMUSG00000020009)
Vector Insertion
Chr 10: 19317337 - 19321125
Public Clones IST14406G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099739 (Chr10:19317222..19317336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGAACCCTGTCGTATGCTG Chr10:19317260..19317279 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099739 (Chr10:19317222..19317336 +)
Downstram Exon
ENSMUSE00000099738 (Chr10:19321126..19321289 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGAACCCTGTCGTATGCTG Chr10:19317260..19317279 59.72 50 TGTTGGTGCAGGAATCAGTC Chr10:19321157..19321176 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000099745 Chr10:19311816..19312003 GGATGATTCTGCTGGTGGTC Chr10:19311917..19311936 60.48 55
upstream ENSMUSE00000099739 Chr10:19317222..19317336 TTGAACCCTGTCGTATGCTG Chr10:19317260..19317279 59.72 50

*** Putative Vector Insertion (Chr 10: 19317337 - 19321125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099738 Chr10:19321126..19321289 TGTTGGTGCAGGAATCAGTC Chr10:19321157..19321176 59.68 50
downstream ENSMUSE00000099743 Chr10:19323560..19323738 TACGAGGACGGAGAGCTGTT Chr10:19323627..19323646 60.01 55
downstream ENSMUSE00000099741 Chr10:19326040..19326226 TTTTTCGACCGTATGTTTCG Chr10:19326072..19326091 58.67 40
downstream ENSMUSE00000099742 Chr10:19327063..19327187 GACGGTAAGAGGAGCAACCA Chr10:19327103..19327122 60.26 55
downstream ENSMUSE00000099744 Chr10:19328943..19330031 AGACTTACGGCTGGCTTTGA Chr10:19329912..19329931 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGCTATCGTCTTCCTGT Chr10:19317306..19317326 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGCTATCGTCTTCCTGT Chr10:19317306..19317326 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020009