Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35416
Trapped Gene
F8 (ENSMUSG00000031196)
Vector Insertion
Chr X: 72457256 - 72497153
Public Clones IST12148B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000264101 (ChrX:72496997..72497152 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTCGTCAGAAATTTTCCA ChrX:72497086..72497105 59.4 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000264101 (ChrX:72496997..72497152 -)
Downstram Exon
ENSMUSE00000264093 (ChrX:72457257..72457401 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTCGTCAGAAATTTTCCA ChrX:72497086..72497105 59.4 40 AGAATGAGTGGGGTGCAAAC ChrX:72457284..72457303 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698083 ChrX:72627834..72627868 No primer for this exon
upstream ENSMUSE00000551042 ChrX:72624826..72625380 GCACTCTTCGCTTGCTTCTT ChrX:72624943..72624962 59.9 50
upstream ENSMUSE00000698082 ChrX:72624826..72624915 CTTGGTGCAGTGGAATTGTC ChrX:72624877..72624896 59.14 50
upstream ENSMUSE00000264308 ChrX:72613438..72613559 CTTTTCCATTCAACACCTCCA ChrX:72613516..72613536 59.96 42.86
upstream ENSMUSE00000264299 ChrX:72611341..72611463 TCATGCTGTTGGTGTGTCCT ChrX:72611359..72611378 60.16 50
upstream ENSMUSE00000264286 ChrX:72599380..72599592 GAATTCAGGCCTCATTGGAG ChrX:72599401..72599420 59.63 50
upstream ENSMUSE00000391501 ChrX:72583559..72583627 No primer for this exon
upstream ENSMUSE00000373172 ChrX:72580035..72580151 TGGCACTCAGAAACAAACGA ChrX:72580124..72580143 60.43 45
upstream ENSMUSE00000264269 ChrX:72579290..72579511 TCTACTGGCACGTGATTGGA ChrX:72579465..72579484 60.26 50
upstream ENSMUSE00000698081 ChrX:72577870..72578098 TCGCTCGGTTGCTAAAAAGT ChrX:72577922..72577941 60.02 45
upstream ENSMUSE00000264259 ChrX:72577840..72578098 TCGCTCGGTTGCTAAAAAGT ChrX:72577922..72577941 60.02 45
upstream ENSMUSE00000264248 ChrX:72576727..72576898 CCTCATCGGATTGGTAGGAA ChrX:72576848..72576867 59.89 50
upstream ENSMUSE00000264238 ChrX:72575697..72575790 AATCAAGCAAGCCGACCATA ChrX:72575759..72575778 60.61 45
upstream ENSMUSE00000264231 ChrX:72568268..72568482 GCCTGACCCGCTATTATTCA ChrX:72568361..72568380 60.06 50
upstream ENSMUSE00000264219 ChrX:72561848..72561998 CTCCCCAATGCAGCTAAAAC ChrX:72561892..72561911 59.71 50
upstream ENSMUSE00000264211 ChrX:72541429..72541638 TGGCATACTGGCACATTCTC ChrX:72541565..72541584 59.68 50
upstream ENSMUSE00000333950 ChrX:72530706..72533718 GCAATGAAGGCCCATCTAAA ChrX:72533273..72533292 60.04 45
upstream ENSMUSE00000264164 ChrX:72512769..72512922 TCAGCCCTTATATCGTGGAGA ChrX:72512833..72512853 59.68 47.62
upstream ENSMUSE00000207178 ChrX:72509853..72510062 CTCCCGTCCCTACTCCTTCT ChrX:72510023..72510042 59.69 60
upstream ENSMUSE00000207181 ChrX:72509148..72509376 ATGCACTCGGGATTAATTGG ChrX:72509348..72509367 59.78 45
upstream ENSMUSE00000207180 ChrX:72508791..72508973 CATGGGCAACAATGAGAACA ChrX:72508875..72508894 60.52 45
upstream ENSMUSE00000207183 ChrX:72507757..72507873 GCCTTATTGGCGAGCACTTA ChrX:72507797..72507816 60.36 50
upstream ENSMUSE00000207186 ChrX:72506984..72507055 AAGCATCCGTGATTTCCAGA ChrX:72507005..72507024 60.6 45
upstream ENSMUSE00000207179 ChrX:72505337..72505422 GGATCAATCAATGCCTGGAG ChrX:72505365..72505384 60.43 50
upstream ENSMUSE00000264101 ChrX:72496997..72497152 TGCTCGTCAGAAATTTTCCA ChrX:72497086..72497105 59.4 40
upstream ENSMUSE00000264093 ChrX:72457257..72457401 GTTTGCACCCCACTCATTCT ChrX:72457306..72457325 59.97 50

*** Putative Vector Insertion (Chr X: 72457256 - 72497153) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264083 ChrX:72456709..72456857 TCCATTCCCAATGGTATGCT ChrX:72456811..72456830 60.15 45
downstream ENSMUSE00000264075 ChrX:72455703..72455879 CTTGCAACCATTGTTTTGGA ChrX:72455830..72455849 59.56 40
downstream ENSMUSE00000369192 ChrX:72418075..72418349 TGGGGGTGAATTCGAAGATA ChrX:72418239..72418258 60.27 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCAGGGTGTAATCGCCTTG ChrX:72497091..72497111 60.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAGACTACGTGACTGGGAAA ChrX:72497089..72497111 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031196