Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35426
Trapped Gene
Tmed1 (ENSMUSG00000032180)
Vector Insertion
Chr 9: 21313697 - 21314632
Public Clones IST14678C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717037 (Chr9:21314438..21314631 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGGCGAGTTCACATTTCT Chr9:21314511..21314530 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717037 (Chr9:21314438..21314631 -)
Downstram Exon
ENSMUSE00000217465 (Chr9:21313698..21313795 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGGCGAGTTCACATTTCT Chr9:21314511..21314530 60.26 50 AAGGTGAAGTCCACGTCCAG Chr9:21313736..21313755 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715153 Chr9:21314438..21314631 GACGGCGAGTTCACATTTCT Chr9:21314511..21314530 60.26 50
upstream ENSMUSE00000717037 Chr9:21314438..21314631 GACGGCGAGTTCACATTTCT Chr9:21314511..21314530 60.26 50
upstream ENSMUSE00000217465 Chr9:21313698..21313795 GAGTCTCGAAAGGCTGATGG Chr9:21313707..21313726 59.95 55

*** Putative Vector Insertion (Chr 9: 21313697 - 21314632) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217470 Chr9:21313375..21313558 GCCCAACCTTCTACCTCCTC Chr9:21313405..21313424 60.07 60
downstream ENSMUSE00000584859 Chr9:21312001..21312835 ATTGGCAGCTGACCAGAAGT Chr9:21312679..21312698 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACTGGCCCTGTGTAATC Chr9:21314576..21314596 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032180