Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35431
Trapped Gene
2310007F21Rik (ENSMUSG00000037257)
Vector Insertion
Chr 9: 63465405 - 63466954
Public Clones IST12256A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359536 (Chr9:63465315..63465404 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTGGTGCATCAAACATGG Chr9:63465338..63465357 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359536 (Chr9:63465315..63465404 +)
Downstram Exon
ENSMUSE00000324399 (Chr9:63466955..63467038 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTGGTGCATCAAACATGG Chr9:63465338..63465357 59.97 50 TCATCACGACATTGGACCAG Chr9:63467035..63467054 60.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367734 Chr9:63450462..63450578 No primer for this exon
upstream ENSMUSE00000430312 Chr9:63464493..63464683 TACCCCTGGACCATCGATAA Chr9:63464552..63464571 60.15 50
upstream ENSMUSE00000584251 Chr9:63464795..63464891 GGTCTTGACAGCGTCTCCTC Chr9:63464801..63464820 59.99 60
upstream ENSMUSE00000359536 Chr9:63465315..63465404 GAGTGGTGCATCAAACATGG Chr9:63465338..63465357 59.97 50

*** Putative Vector Insertion (Chr 9: 63465405 - 63466954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000324399 Chr9:63466955..63467038 TCATCACGACATTGGACCAG Chr9:63467035..63467054 60.53 50
downstream ENSMUSE00000324377 Chr9:63483112..63483194 CTCTGCTGATGCAACTCTGC Chr9:63483182..63483201 59.89 55
downstream ENSMUSE00000402032 Chr9:63484191..63484290 CGACAATGCTGTCAACCTGT Chr9:63484293..63484312 59.75 50
downstream ENSMUSE00000324317 Chr9:63486847..63486951 CTCCAGATCACCTCCTCCAG Chr9:63486914..63486933 59.78 60
downstream ENSMUSE00000324294 Chr9:63487400..63487449 TGCATGCAACTTTCTTTGCT Chr9:63487446..63487465 59.61 40
downstream ENSMUSE00000388239 Chr9:63488014..63489696 GGTGGTAAACCCAAGCTCAA Chr9:63489466..63489485 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAACTCAACCCAGAGGA Chr9:63465369..63465389 60.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGAACTCAACCCAGAGGA Chr9:63465369..63465389 60.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037257