Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35435
Trapped Gene
Zhx3 (ENSMUSG00000035877)
Vector Insertion
Chr 2: 160604960 - 160658155
Public Clones IST12256A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000431105 (Chr2:160658033..160658154 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAGCAAACGACTCCTTA Chr2:160658116..160658135 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000431105 (Chr2:160658033..160658154 -)
Downstram Exon
ENSMUSE00000227776 (Chr2:160604961..160608115 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAGCAAACGACTCCTTA Chr2:160658116..160658135 60.01 50 TGCAGTTGGTCTGAATGCTC Chr2:160604999..160605018 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680406 Chr2:160698527..160698726 AGTTGGTGCTGCTCGTCTTC Chr2:160698680..160698699 60.6 55
upstream ENSMUSE00000661299 Chr2:160685204..160685367 CACAAACAGGCTGGATGAAA Chr2:160685325..160685344 59.69 45
upstream ENSMUSE00000551991 Chr2:160662995..160663065 GGTCCTAAGTGGGTTTCTTCCT Chr2:160663010..160663031 59.87 50
upstream ENSMUSE00000661296 Chr2:160662995..160663062 GGTCCTAAGTGGGTTTCTTCCT Chr2:160663010..160663031 59.87 50
upstream ENSMUSE00000431105 Chr2:160658033..160658154 AGGCAGCAAACGACTCCTTA Chr2:160658116..160658135 60.01 50
upstream ENSMUSE00000661298 Chr2:160605137..160608115 GAAGCTTCTGTCGGAACCAG Chr2:160606446..160606465 59.99 55
upstream ENSMUSE00000708090 Chr2:160605137..160608115 GAAGCTTCTGTCGGAACCAG Chr2:160606446..160606465 59.99 55
upstream ENSMUSE00000227776 Chr2:160604961..160608115 GAAGCTTCTGTCGGAACCAG Chr2:160606446..160606465 59.99 55

*** Putative Vector Insertion (Chr 2: 160604960 - 160658155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680403 Chr2:160596183..160597361 TTCCACATGGCATACAGCAT Chr2:160597270..160597289 59.96 45
downstream ENSMUSE00000661297 Chr2:160591518..160597361 ACATTTGGGCTTGCCACTAC Chr2:160593376..160593395 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTACACCTAATCGCCTTGCAG Chr2:160631090..160631111 59.78 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCAAGCTGTTTTGGTCAGA Chr2:160649155..160649177 60.03 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035877