Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35436
Trapped Gene
4930449E01Rik (ENSMUSG00000022116)
Vector Insertion
Chr 14: 105898299 - 105904442
Public Clones IST12936D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000123718 (Chr14:105898005..105898298 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAACACTTTCTGCGACTGG Chr14:105898192..105898211 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000123718 (Chr14:105898005..105898298 +)
Downstram Exon
ENSMUSE00000123717 (Chr14:105904443..105904647 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAACACTTTCTGCGACTGG Chr14:105898192..105898211 60.03 50 TCCAATTGTCCGAAGGTTTC Chr14:105904551..105904570 59.91 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000123718 Chr14:105898005..105898298 TCAACACTTTCTGCGACTGG Chr14:105898192..105898211 60.03 50

*** Putative Vector Insertion (Chr 14: 105898299 - 105904442) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000123717 Chr14:105904443..105904647 TCCAATTGTCCGAAGGTTTC Chr14:105904551..105904570 59.91 45
downstream ENSMUSE00000123716 Chr14:105904744..105904839 CTTCCAGCTTCAGCTTGGTC Chr14:105904784..105904803 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr14:105901347..105901367 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGGCCAAATTTAACGTG Chr14:105901334..105901354 58.02 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022116