Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35456
Trapped Gene
Rtkn2 (ENSMUSG00000037846)
Vector Insertion
Chr 10: 67504126 - 67505353
Public Clones IST10064G2 (tigm) IST10064G2 (tigm) IST12902F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441512 (Chr10:67504127..67506612 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCGTGAAACTGGAAAGT Chr10:67504136..67504155 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441512 (Chr10:67504127..67506612 +)
Downstram Exon
ENSMUSE00000666217 (Chr10:67505261..67505352 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCGTGAAACTGGAAAGT Chr10:67504136..67504155 60.01 50 AGGATTTCAGGGCTCATCAA Chr10:67505316..67505335 59.63 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717549 Chr10:67442318..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000666222 Chr10:67442346..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000575810 Chr10:67442353..67442560 GAGGCTCCTAGTACGCTTGC Chr10:67442385..67442404 59.25 60
upstream ENSMUSE00000720154 Chr10:67442463..67442560 No primer for this exon
upstream ENSMUSE00000612270 Chr10:67450055..67450251 TGCTCTCGCTGAGTACGAAA Chr10:67450116..67450135 59.89 50
upstream ENSMUSE00000666218 Chr10:67450055..67450260 TGCTCTCGCTGAGTACGAAA Chr10:67450116..67450135 59.89 50
upstream ENSMUSE00000612269 Chr10:67460313..67460371 ATCCTGCAGAGGAAAGATCG Chr10:67460343..67460362 59.39 50
upstream ENSMUSE00000612268 Chr10:67464672..67464725 TGTGGAAAGACTCCGATCACT Chr10:67464690..67464710 59.71 47.62
upstream ENSMUSE00000612267 Chr10:67465952..67466069 TTGACACGGACATGGTGATT Chr10:67466003..67466022 59.81 45
upstream ENSMUSE00000612266 Chr10:67468248..67468442 CAGGACCGGACTTCCAGATA Chr10:67468256..67468275 60.06 55
upstream ENSMUSE00000666221 Chr10:67468248..67468437 CAGGACCGGACTTCCAGATA Chr10:67468256..67468275 60.06 55
upstream ENSMUSE00000666220 Chr10:67476654..67476663 No primer for this exon
upstream ENSMUSE00000612265 Chr10:67480554..67480648 ACCATTTGCTGGCTCATACC Chr10:67480565..67480584 59.96 50
upstream ENSMUSE00000666219 Chr10:67480556..67480648 ACCATTTGCTGGCTCATACC Chr10:67480565..67480584 59.96 50
upstream ENSMUSE00000612264 Chr10:67488261..67488367 TGCATTTGCAGGATTCCTTA Chr10:67488340..67488359 59.26 40
upstream ENSMUSE00000289340 Chr10:67489266..67489397 TGGTCCGGAAGAAATTGAAG Chr10:67489340..67489359 60.04 45
upstream ENSMUSE00000289329 Chr10:67498537..67498699 TCCGGCAACATTTCTTTGAT Chr10:67498676..67498695 60.45 40
upstream ENSMUSE00000366897 Chr10:67502779..67502886 AAGGAGGCGACCTCAGTGTA Chr10:67502856..67502875 59.87 55

*** Putative Vector Insertion (Chr 10: 67504126 - 67505353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441512 Chr10:67504127..67506612 ATGGGTTGGTCCGATCAATA Chr10:67506033..67506052 60.01 45
downstream ENSMUSE00000612263 Chr10:67504127..67504702 ATTCGCTCTACCCTGGGTTT Chr10:67504404..67504423 59.96 50
downstream ENSMUSE00000718667 Chr10:67504127..67506616 ATGGGTTGGTCCGATCAATA Chr10:67506033..67506052 60.01 45
downstream ENSMUSE00000721117 Chr10:67504127..67505046 ATTCGCTCTACCCTGGGTTT Chr10:67504404..67504423 59.96 50
downstream ENSMUSE00000666217 Chr10:67505261..67505352 AGGATTTCAGGGCTCATCAA Chr10:67505316..67505335 59.63 45
downstream ENSMUSE00000666216 Chr10:67520634..67521006 GACCATTGCTTCTGGTCACA Chr10:67520961..67520980 59.68 50
downstream ENSMUSE00000666215 Chr10:67521862..67521903 GGGCGATAGCAATCTTCCTT Chr10:67521893..67521912 60.55 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCCGTGAAACTGGAAAGT Chr10:67504137..67504157 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCCGTGAAACTGGAAAGT Chr10:67504137..67504157 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037846