Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35463
Trapped Gene
Tigd3 (ENSMUSG00000044390)
Vector Insertion
Chr 19: 5891138 - 5894108
Public Clones IST14580C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441106 (Chr19:5893970..5894107 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGTCACTCTCTGGTTCTG Chr19:5894027..5894046 60.85 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441106 (Chr19:5893970..5894107 -)
Downstram Exon
ENSMUSE00000395106 (Chr19:5891139..5893114 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGTCACTCTCTGGTTCTG Chr19:5894027..5894046 60.85 60 CTTTGTCCAGGGACAGTGGT Chr19:5891950..5891969 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441106 Chr19:5893970..5894107 CCCGTCACTCTCTGGTTCTG Chr19:5894027..5894046 60.85 60
upstream ENSMUSE00000395106 Chr19:5891139..5893114 AGGTGGACCGACTTCCTTTT Chr19:5891393..5891412 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTTCCCAGCCTTGAGAGA Chr19:5891125..5891145 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTTCCCAGCCTTGAGAGA Chr19:5891125..5891145 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044390