Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35482
Trapped Gene
Slc12a7 (ENSMUSG00000017756)
Vector Insertion
Chr 13: 73870786 - 73901150
Public Clones IST12838G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000446840 (Chr13:73870542..73870785 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000446840 (Chr13:73870542..73870785 +)
Downstram Exon
ENSMUSE00000332532 (Chr13:73901151..73901338 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000446840 Chr13:73870542..73870785 No primer for this exon

*** Putative Vector Insertion (Chr 13: 73870786 - 73901150) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332532 Chr13:73901151..73901338 No primer for this exon
downstream ENSMUSE00000119018 Chr13:73921967..73922061 No primer for this exon
downstream ENSMUSE00000367617 Chr13:73922492..73922614 No primer for this exon
downstream ENSMUSE00000400367 Chr13:73926013..73926159 No primer for this exon
downstream ENSMUSE00000570289 Chr13:73927389..73927443 No primer for this exon
downstream ENSMUSE00000570286 Chr13:73928098..73928228 No primer for this exon
downstream ENSMUSE00000351860 Chr13:73929998..73930239 No primer for this exon
downstream ENSMUSE00000384619 Chr13:73931372..73931583 No primer for this exon
downstream ENSMUSE00000344046 Chr13:73932546..73932713 No primer for this exon
downstream ENSMUSE00000446804 Chr13:73932933..73933150 No primer for this exon
downstream ENSMUSE00000334593 Chr13:73933052..73933150 No primer for this exon
downstream ENSMUSE00000377344 Chr13:73934215..73934272 No primer for this exon
downstream ENSMUSE00000446799 Chr13:73934215..73934392 No primer for this exon
downstream ENSMUSE00000570284 Chr13:73934975..73935149 No primer for this exon
downstream ENSMUSE00000369848 Chr13:73935867..73935985 No primer for this exon
downstream ENSMUSE00000570283 Chr13:73936391..73936489 No primer for this exon
downstream ENSMUSE00000570282 Chr13:73937061..73937180 No primer for this exon
downstream ENSMUSE00000570281 Chr13:73937833..73937937 No primer for this exon
downstream ENSMUSE00000396225 Chr13:73938376..73938544 No primer for this exon
downstream ENSMUSE00000341694 Chr13:73942862..73943057 No primer for this exon
downstream ENSMUSE00000570279 Chr13:73943477..73943646 No primer for this exon
downstream ENSMUSE00000570278 Chr13:73943754..73943885 No primer for this exon
downstream ENSMUSE00000393809 Chr13:73946433..73946540 No primer for this exon
downstream ENSMUSE00000411805 Chr13:73947354..73947532 No primer for this exon
downstream ENSMUSE00000570276 Chr13:73950987..73951120 No primer for this exon
downstream ENSMUSE00000404490 Chr13:73952291..73954200 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAACGGGGTAACCTGAGCTA Chr13:73891803..73891824 60.01 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGACCAAGCAGTGACAGG Chr13:73879817..73879837 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017756