Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35484
Trapped Gene
Unc13c (ENSMUSG00000062151)
Vector Insertion
Chr 9: 73426175 - 73477042
Public Clones IST14629B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695900 (Chr9:73476956..73477041 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGGGAAGATAAGTGCAGA Chr9:73477003..73477023 60.08 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695900 (Chr9:73476956..73477041 -)
Downstram Exon
ENSMUSE00000635574 (Chr9:73426176..73426302 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGGGAAGATAAGTGCAGA Chr9:73477003..73477023 60.08 47.62 GTGCTCTTGCATAAGCGTTG Chr9:73426250..73426269 59.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713058 Chr9:73778404..73781374 CAGAGGATAGGGCAGCAAAG Chr9:73780284..73780303 59.97 55
upstream ENSMUSE00000714407 Chr9:73778404..73781374 CAGAGGATAGGGCAGCAAAG Chr9:73780284..73780303 59.97 55
upstream ENSMUSE00000695895 Chr9:73660758..73660780 No primer for this exon
upstream ENSMUSE00000695909 Chr9:73660758..73660780 No primer for this exon
upstream ENSMUSE00000441753 Chr9:73660133..73660197 CTTCCAAATTCTCCGCACTC Chr9:73660147..73660166 59.81 50
upstream ENSMUSE00000695894 Chr9:73660133..73660197 CTTCCAAATTCTCCGCACTC Chr9:73660147..73660166 59.81 50
upstream ENSMUSE00000441743 Chr9:73606406..73606484 GGGCGTGGACTGTATGGTAT Chr9:73606461..73606480 59.7 55
upstream ENSMUSE00000695893 Chr9:73606406..73606484 GGGCGTGGACTGTATGGTAT Chr9:73606461..73606480 59.7 55
upstream ENSMUSE00000695908 Chr9:73605759..73605764 No primer for this exon
upstream ENSMUSE00000441739 Chr9:73604142..73604213 GGAAATCTGGTCTCTCCCTTG Chr9:73604180..73604200 60.06 52.38
upstream ENSMUSE00000695892 Chr9:73604142..73604218 GGAAATCTGGTCTCTCCCTTG Chr9:73604180..73604200 60.06 52.38
upstream ENSMUSE00000518355 Chr9:73597289..73597508 GGTGAAATGCCACGAGAAGT Chr9:73597322..73597341 60.12 50
upstream ENSMUSE00000695891 Chr9:73597289..73597508 GGTGAAATGCCACGAGAAGT Chr9:73597322..73597341 60.12 50
upstream ENSMUSE00000441730 Chr9:73584324..73584551 GTCGAAGTGGTCTGCAAAAA Chr9:73584336..73584355 58.9 45
upstream ENSMUSE00000695890 Chr9:73584324..73584551 GTCGAAGTGGTCTGCAAAAA Chr9:73584336..73584355 58.9 45
upstream ENSMUSE00000441726 Chr9:73582211..73582352 ATCCAGTGTGGGACGAGAAG Chr9:73582219..73582238 60.11 55
upstream ENSMUSE00000695889 Chr9:73582211..73582352 ATCCAGTGTGGGACGAGAAG Chr9:73582219..73582238 60.11 55
upstream ENSMUSE00000441723 Chr9:73546908..73547077 TTCTGGGACAGACGATTGTG Chr9:73546954..73546973 59.68 50
upstream ENSMUSE00000695888 Chr9:73546908..73547077 TTCTGGGACAGACGATTGTG Chr9:73546954..73546973 59.68 50
upstream ENSMUSE00000441714 Chr9:73542678..73542793 GGCCATCCGACTAAAAATCA Chr9:73542743..73542762 59.9 45
upstream ENSMUSE00000695887 Chr9:73542678..73542793 GGCCATCCGACTAAAAATCA Chr9:73542743..73542762 59.9 45
upstream ENSMUSE00000531864 Chr9:73541012..73541175 TGAATTTGCCATGCGTTATG Chr9:73541040..73541059 60.47 40
upstream ENSMUSE00000695886 Chr9:73541012..73541175 TGAATTTGCCATGCGTTATG Chr9:73541040..73541059 60.47 40
upstream ENSMUSE00000494830 Chr9:73528144..73528300 CTGATCGCTTTGCTGCTACA Chr9:73528153..73528172 60.3 50
upstream ENSMUSE00000695885 Chr9:73528144..73528300 CTGATCGCTTTGCTGCTACA Chr9:73528153..73528172 60.3 50
upstream ENSMUSE00000695884 Chr9:73517299..73517367 TGGACCAGTTGCATAACTCCT Chr9:73517325..73517345 59.61 47.62
upstream ENSMUSE00000695904 Chr9:73517299..73517367 TGGACCAGTTGCATAACTCCT Chr9:73517325..73517345 59.61 47.62
upstream ENSMUSE00000695883 Chr9:73515365..73515454 TGTTGACCAGCATCACCTTC Chr9:73515377..73515396 59.68 50
upstream ENSMUSE00000695903 Chr9:73515365..73515454 TGTTGACCAGCATCACCTTC Chr9:73515377..73515396 59.68 50
upstream ENSMUSE00000695882 Chr9:73513345..73513473 TCGACAACTGCCATGAACTC Chr9:73513366..73513385 59.84 50
upstream ENSMUSE00000695902 Chr9:73513345..73513473 TCGACAACTGCCATGAACTC Chr9:73513366..73513385 59.84 50
upstream ENSMUSE00000695881 Chr9:73486859..73486992 CCAAGAACCTGGACTTCTGG Chr9:73486930..73486949 59.69 55
upstream ENSMUSE00000695901 Chr9:73486859..73486992 CCAAGAACCTGGACTTCTGG Chr9:73486930..73486949 59.69 55
upstream ENSMUSE00000695880 Chr9:73476956..73477041 CATGGGGAAGATAAGTGCAGA Chr9:73477003..73477023 60.08 47.62
upstream ENSMUSE00000695900 Chr9:73476956..73477041 CATGGGGAAGATAAGTGCAGA Chr9:73477003..73477023 60.08 47.62
upstream ENSMUSE00000635574 Chr9:73426176..73426302 CAACGCTTATGCAAGAGCAC Chr9:73426272..73426291 59.64 50
upstream ENSMUSE00000695898 Chr9:73426176..73426302 CAACGCTTATGCAAGAGCAC Chr9:73426272..73426291 59.64 50

*** Putative Vector Insertion (Chr 9: 73426175 - 73477042) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635573 Chr9:73421816..73421912 No primer for this exon
downstream ENSMUSE00000695879 Chr9:73421816..73421912 No primer for this exon
downstream ENSMUSE00000635572 Chr9:73420139..73420282 TGATAGGGCTTCAGGATTGG Chr9:73420141..73420160 60.03 50
downstream ENSMUSE00000695878 Chr9:73420139..73420282 TGATAGGGCTTCAGGATTGG Chr9:73420141..73420160 60.03 50
downstream ENSMUSE00000635571 Chr9:73411826..73411903 GATACGATCGCAGCGTACTG Chr9:73411841..73411860 59.47 55
downstream ENSMUSE00000695877 Chr9:73411826..73411903 GATACGATCGCAGCGTACTG Chr9:73411841..73411860 59.47 55
downstream ENSMUSE00000635570 Chr9:73406746..73406823 CGCAGTTGTTGGATGTTGTT Chr9:73406767..73406786 59.62 45
downstream ENSMUSE00000695876 Chr9:73406746..73406823 CGCAGTTGTTGGATGTTGTT Chr9:73406767..73406786 59.62 45
downstream ENSMUSE00000635569 Chr9:73393780..73393868 ACCCCGTTGAGTTTGATTTG Chr9:73393791..73393810 59.83 45
downstream ENSMUSE00000695875 Chr9:73393780..73393868 ACCCCGTTGAGTTTGATTTG Chr9:73393791..73393810 59.83 45
downstream ENSMUSE00000635568 Chr9:73388040..73388189 ATCGCCGCACTGTTCTTATT Chr9:73388066..73388085 59.74 45
downstream ENSMUSE00000695874 Chr9:73388040..73388189 ATCGCCGCACTGTTCTTATT Chr9:73388066..73388085 59.74 45
downstream ENSMUSE00000635567 Chr9:73381715..73381838 CCTTCAGAACTCGCTTCAGG Chr9:73381761..73381780 60.13 55
downstream ENSMUSE00000635566 Chr9:73378721..73378777 No primer for this exon
downstream ENSMUSE00000635565 Chr9:73373759..73373839 CCTTGGCATCTTCTCGAATC Chr9:73373790..73373809 59.77 50
downstream ENSMUSE00000635564 Chr9:73365046..73365193 TTCTTCTTCAGGCCATTTCC Chr9:73365134..73365153 59.24 45
downstream ENSMUSE00000583978 Chr9:73332689..73332781 GGCCTACAGCATCTTTGGAG Chr9:73332733..73332752 59.84 55
downstream ENSMUSE00000583977 Chr9:73331425..73331584 ACTTCGGTGACCATGTGTTG Chr9:73331422..73331441 59.44 50
downstream ENSMUSE00000635563 Chr9:73327229..73328962 TTCTCGGGCAAAGCAGTAGT Chr9:73328865..73328884 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACCACAAGAGGGAATGG Chr9:73468069..73468089 60.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACCACAAGAGGGAATGG Chr9:73468069..73468089 60.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062151