Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35489
Trapped Gene
Slc35f1 (ENSMUSG00000038602)
Vector Insertion
Chr 10: 52653074 - 52740220
Public Clones IST14652C12 (tigm) IST10378G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492555 (Chr10:52652898..52653073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTTCATGCGAACACACCA Chr10:52652984..52653003 59.97 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492555 (Chr10:52652898..52653073 +)
Downstram Exon
ENSMUSE00000666373 (Chr10:52740221..52740248 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTTCATGCGAACACACCA Chr10:52652984..52653003 59.97 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000494917 Chr10:52410803..52410975 GTGACCACCATCGAGAACCT Chr10:52410872..52410891 59.97 55
upstream ENSMUSE00000492555 Chr10:52652898..52653073 ATTTTCATGCGAACACACCA Chr10:52652984..52653003 59.97 40

*** Putative Vector Insertion (Chr 10: 52653074 - 52740220) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666373 Chr10:52740221..52740248 No primer for this exon
downstream ENSMUSE00000666372 Chr10:52741047..52741067 No primer for this exon
downstream ENSMUSE00000666369 Chr10:52741058..52741067 No primer for this exon
downstream ENSMUSE00000516191 Chr10:52741650..52741777 AAGCCTTGACCACCAGGTAA Chr10:52741751..52741770 59.59 50
downstream ENSMUSE00000302060 Chr10:52782257..52782416 CAGACTACGATGCCGATGAA Chr10:52782357..52782376 59.82 50
downstream ENSMUSE00000302052 Chr10:52793260..52793416 CTCAGGGTTCGGATAATGGA Chr10:52793359..52793378 59.89 50
downstream ENSMUSE00000302039 Chr10:52797703..52797755 No primer for this exon
downstream ENSMUSE00000708305 Chr10:52809144..52809298 ATGCAGGCACTAAAGCCAAC Chr10:52809177..52809196 60.28 50
downstream ENSMUSE00000715403 Chr10:52809144..52809298 ATGCAGGCACTAAAGCCAAC Chr10:52809177..52809196 60.28 50
downstream ENSMUSE00000509357 Chr10:52827954..52828502 ACACGTACATGGGGCTCTTC Chr10:52828174..52828193 60 55
downstream ENSMUSE00000666370 Chr10:52827954..52828022 GGTGGAGGAATACAGCACCA Chr10:52828022..52828041 60.92 55
downstream ENSMUSE00000666374 Chr10:52827954..52831188 ACACGTACATGGGGCTCTTC Chr10:52828174..52828193 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGAGCAAAGTGTGGCTCT Chr10:52659068..52659088 60.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGAGCAAAGTGTGGCTCT Chr10:52659068..52659088 60.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038602