Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35495
Trapped Gene
Spnb5 (ENSMUSG00000079118)
Vector Insertion
Chr 2: 119890162 - 119891470
Public Clones IST14440G12 (tigm) IST14440G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642055 (Chr2:119891353..119891469 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGTGGGCTCATTAGGAA Chr2:119891360..119891379 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642055 (Chr2:119891353..119891469 -)
Downstram Exon
ENSMUSE00000685192 (Chr2:119890163..119890308 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGTGGGCTCATTAGGAA Chr2:119891360..119891379 59.55 50 AAATTCAGCAAGGGTCTGGA Chr2:119890209..119890228 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642058 Chr2:119898107..119898259 TCAATCGCCCTGTTTAGCTT Chr2:119898216..119898235 59.85 45
upstream ENSMUSE00000685202 Chr2:119897698..119897828 TTCTCATGACCTTGGCCACT Chr2:119897805..119897824 60.66 50
upstream ENSMUSE00000685201 Chr2:119897234..119897473 GGGACAGCCATCATACCCTA Chr2:119897302..119897321 59.77 55
upstream ENSMUSE00000685200 Chr2:119896023..119896310 TGGAACCCTACAGGAGGAGA Chr2:119896042..119896061 59.65 55
upstream ENSMUSE00000685199 Chr2:119894884..119895124 AGATGATTTCATGGCCACCT Chr2:119894925..119894944 59.37 45
upstream ENSMUSE00000685198 Chr2:119894620..119894759 GACATAAGGGAGGCCCAGAG Chr2:119894737..119894756 60.98 60
upstream ENSMUSE00000685197 Chr2:119894381..119894480 GTGAGCAGAGAAGGGTCCAG Chr2:119894405..119894424 59.99 60
upstream ENSMUSE00000685196 Chr2:119893648..119893818 CCTCTCGGAGGTACATGGAA Chr2:119893660..119893679 60.06 55
upstream ENSMUSE00000685195 Chr2:119893183..119893347 TGCACAGGAGGACATACAGG Chr2:119893296..119893315 59.7 55
upstream ENSMUSE00000685194 Chr2:119892593..119892807 GCATTCACTTCCTGGACCAT Chr2:119892623..119892642 59.93 50
upstream ENSMUSE00000685193 Chr2:119892115..119892301 ACAGCCTTCAACGAAAGCAC Chr2:119892118..119892137 60.44 50
upstream ENSMUSE00000642057 Chr2:119891683..119891883 GTGAAGAACGTGCACACTGC Chr2:119891710..119891729 60.52 55
upstream ENSMUSE00000642055 Chr2:119891353..119891469 ACCAGTGGGCTCATTAGGAA Chr2:119891360..119891379 59.55 50
upstream ENSMUSE00000685192 Chr2:119890163..119890308 CTCGAGCAGAGGTTCCAGAC Chr2:119890244..119890263 60.13 60

*** Putative Vector Insertion (Chr 2: 119890162 - 119891470) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685191 Chr2:119889662..119889797 GCTCATGGTCCTCTCCAAAG Chr2:119889648..119889667 59.8 55
downstream ENSMUSE00000685190 Chr2:119889340..119889485 AGTCGACAGGTTTCCACTCG Chr2:119889390..119889409 60.3 55
downstream ENSMUSE00000685189 Chr2:119888413..119888527 CAGAAGGTCTCCGTGGACTC Chr2:119888412..119888431 59.83 60
downstream ENSMUSE00000642054 Chr2:119888220..119888330 AGCTGGTTCTCTACCCCACA Chr2:119888247..119888266 59.72 55
downstream ENSMUSE00000685188 Chr2:119887820..119888002 TCCAGCCTTCATCAGTTCCT Chr2:119887957..119887976 59.8 50
downstream ENSMUSE00000685187 Chr2:119887322..119887528 TCCTCCTTGGCTTTCAGTTC Chr2:119887370..119887389 59.4 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000079118