Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35497
Trapped Gene
Ttc1 (ENSMUSG00000041278)
Vector Insertion
Chr 11: 43558586 - 43561485
Public Clones IST14333F4 (tigm) IST10543A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261891 (Chr11:43561424..43561484 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261891 (Chr11:43561424..43561484 -)
Downstram Exon
ENSMUSE00000720319 (Chr11:43558587..43558949 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60 AACATGGTCGTCCTGTGGAT Chr11:43558721..43558740 60.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000261891 Chr11:43561424..43561484 GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60
upstream ENSMUSE00000679715 Chr11:43561424..43561510 GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60
upstream ENSMUSE00000261887 Chr11:43558587..43558949 CATGGTTTCTGATCCCAAGG Chr11:43558805..43558824 60.31 50
upstream ENSMUSE00000720319 Chr11:43558587..43558949 CATGGTTTCTGATCCCAAGG Chr11:43558805..43558824 60.31 50

*** Putative Vector Insertion (Chr 11: 43558586 - 43561485) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261882 Chr11:43555263..43555323 TCATTCCCCTCCTCCTTTAG Chr11:43555258..43555277 58.19 50
downstream ENSMUSE00000261873 Chr11:43553219..43553331 TCCTCGCAGCAGCTCTATTT Chr11:43553205..43553224 60.26 50
downstream ENSMUSE00000261867 Chr11:43552299..43552335 No primer for this exon
downstream ENSMUSE00000261860 Chr11:43551369..43551517 CACGGATATAGGTGGGGTTT Chr11:43551466..43551485 58.65 50
downstream ENSMUSE00000261850 Chr11:43549921..43549975 No primer for this exon
downstream ENSMUSE00000679714 Chr11:43549917..43549975 No primer for this exon
downstream ENSMUSE00000394807 Chr11:43543511..43544109 TCTGTGCGGCTCTAAGAGGT Chr11:43543662..43543681 60.16 55
downstream ENSMUSE00000679713 Chr11:43543014..43544109 GACCTCGATGGAAACCAGAA Chr11:43543393..43543412 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCCCATCGTGGGTCTAAT Chr11:43561430..43561450 60.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000041278