Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35506
Trapped Gene
Mertk (ENSMUSG00000014361)
Vector Insertion
Chr 2: 128609747 - 128615952
Public Clones IST14639G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169021 (Chr2:128609628..128609746 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGACCTCCACACCTTCCTG Chr2:128609697..128609716 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169021 (Chr2:128609628..128609746 +)
Downstram Exon
ENSMUSE00000169026 (Chr2:128615953..128616062 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGACCTCCACACCTTCCTG Chr2:128609697..128609716 59.68 60 AGCTGCCAAATCCCTATGAA Chr2:128616054..128616073 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000315650 Chr2:128524733..128524839 No primer for this exon
upstream ENSMUSE00000397023 Chr2:128554922..128555330 TGGGAAGAGACCGAGCTAGA Chr2:128554936..128554955 60.09 55
upstream ENSMUSE00000361744 Chr2:128562299..128562399 No primer for this exon
upstream ENSMUSE00000315628 Chr2:128563932..128564105 TCCTGAGCCCGTCAATATCT Chr2:128564017..128564036 59.65 50
upstream ENSMUSE00000416245 Chr2:128575836..128575922 AAGGACTGACGGTGTCCAAG Chr2:128575881..128575900 60.15 55
upstream ENSMUSE00000169030 Chr2:128577643..128577758 GATGGCTACTCCCCACTTCA Chr2:128577723..128577742 60.07 55
upstream ENSMUSE00000169023 Chr2:128584779..128584962 AGCCCTGGCTAATTACAGCA Chr2:128584868..128584887 59.87 50
upstream ENSMUSE00000169014 Chr2:128587813..128587964 TGGGCTACCGGATATCTCAC Chr2:128587921..128587940 59.92 55
upstream ENSMUSE00000169028 Chr2:128597083..128597236 GAATCGCGGCCATTACTAAA Chr2:128597165..128597184 60.06 45
upstream ENSMUSE00000169022 Chr2:128602022..128602175 CCTGGCAACACCGACTCTAT Chr2:128602057..128602076 60.13 55
upstream ENSMUSE00000169015 Chr2:128603149..128603234 GGATTCCCAACTGGTCGTAA Chr2:128603167..128603186 59.79 50
upstream ENSMUSE00000169019 Chr2:128604651..128604746 TCTGGTTCTCGGCAAAGTTC Chr2:128604718..128604737 60.38 50
upstream ENSMUSE00000169020 Chr2:128605528..128605608 TGGCAGTGAAGACCATGAAG Chr2:128605588..128605607 59.83 50
upstream ENSMUSE00000169024 Chr2:128608259..128608351 AACGGGAGATCGAGGAGTTT Chr2:128608274..128608293 60.07 50
upstream ENSMUSE00000169021 Chr2:128609628..128609746 GAGACCTCCACACCTTCCTG Chr2:128609697..128609716 59.68 60

*** Putative Vector Insertion (Chr 2: 128609747 - 128615952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169026 Chr2:128615953..128616062 AGCTGCCAAATCCCTATGAA Chr2:128616054..128616073 59.67 45
downstream ENSMUSE00000169017 Chr2:128618682..128618841 CGCAGACAGTCATGTCATCC Chr2:128618710..128618729 60.28 55
downstream ENSMUSE00000169018 Chr2:128620178..128620314 GAACTCCGGGATAGGGAGTC Chr2:128620244..128620263 59.9 60
downstream ENSMUSE00000393580 Chr2:128626890..128627924 TCCTCCGGTAAGACACCATC Chr2:128627285..128627304 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACCTCCACACCTTCCTG Chr2:128609698..128609718 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACCTCCACACCTTCCTG Chr2:128609698..128609718 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014361