Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35508
Trapped Gene
Lmtk3 (ENSMUSG00000062044)
Vector Insertion
Chr 7: 53056420 - 53059001
Public Clones IST14153H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000497491 (Chr7:53056282..53056419 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTCCGTCTCACCTGCACT Chr7:53056353..53056372 61.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000497491 (Chr7:53056282..53056419 +)
Downstram Exon
ENSMUSE00000674254 (Chr7:53059002..53059479 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTCCGTCTCACCTGCACT Chr7:53056353..53056372 61.01 55 GAAAATGTCACGCGAAGGTT Chr7:53059473..53059492 60.12 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000713660 Chr7:53039108..53039350 CTTCCATTCCACGATGATCC Chr7:53039163..53039182 60.28 50
upstream ENSMUSE00000674271 Chr7:53039317..53039350 No primer for this exon
upstream ENSMUSE00000718506 Chr7:53040750..53041051 CATCCCTTCATCCGTCTGTC Chr7:53040766..53040785 60.47 55
upstream ENSMUSE00000531748 Chr7:53040939..53041051 TCCCTTCCATCCTGGACAAG Chr7:53040956..53040975 62.35 55
upstream ENSMUSE00000710942 Chr7:53040939..53041051 TCCCTTCCATCCTGGACAAG Chr7:53040956..53040975 62.35 55
upstream ENSMUSE00000478987 Chr7:53041821..53041954 CCTACGCTGTGGTCCTCATT Chr7:53041857..53041876 60.13 55
upstream ENSMUSE00000487194 Chr7:53042180..53042330 CAGTCGCTGCCTGATGTCTA Chr7:53042252..53042271 60.16 55
upstream ENSMUSE00000488267 Chr7:53042764..53042840 AGCTACCTGCAGGAGATTGG Chr7:53042802..53042821 59.45 55
upstream ENSMUSE00000499910 Chr7:53043274..53043392 AAGTTCATCTCCGAGGCTCA Chr7:53043364..53043383 59.95 50
upstream ENSMUSE00000504709 Chr7:53046245..53046332 ACCTTGCCCTTCCTGTTGAT Chr7:53046294..53046313 60.88 50
upstream ENSMUSE00000501686 Chr7:53046665..53046813 TCTAGAGATTGCCCGAGGAC Chr7:53046760..53046779 59.39 55
upstream ENSMUSE00000531743 Chr7:53047681..53047765 CCTGACTGTGCGTATTGGAG Chr7:53047717..53047736 59.31 55
upstream ENSMUSE00000531742 Chr7:53047847..53047968 GATCAAAGCCGGGAGAGTAA Chr7:53047943..53047962 59.27 50
upstream ENSMUSE00000531740 Chr7:53048061..53048210 GCTGCCCTACGCTGACTATT Chr7:53048190..53048209 59.5 55
upstream ENSMUSE00000594500 Chr7:53048494..53050931 GAGACCGAGACCCCTTTTTC Chr7:53049719..53049738 60.05 55
upstream ENSMUSE00000594499 Chr7:53053569..53053963 CGTGACCGTCTACCTCTTCG Chr7:53053939..53053958 60.84 60
upstream ENSMUSE00000531729 Chr7:53055806..53055941 CTCCAACCAACGAGTTGAGC Chr7:53055810..53055829 60.83 55
upstream ENSMUSE00000497491 Chr7:53056282..53056419 TTCTCCGTCTCACCTGCACT Chr7:53056353..53056372 61.01 55

*** Putative Vector Insertion (Chr 7: 53056420 - 53059001) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674254 Chr7:53059002..53059479 GAAAATGTCACGCGAAGGTT Chr7:53059473..53059492 60.12 45
downstream ENSMUSE00000719530 Chr7:53059002..53059514 GAAAATGTCACGCGAAGGTT Chr7:53059473..53059492 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCAGCAGGACCCTATCC Chr7:53056429..53056449 60.98 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCCAGCAGGACCCTATCC Chr7:53056429..53056449 60.98 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062044