Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35529
Trapped Gene
Hirip3 (ENSMUSG00000042606)
Vector Insertion
Chr 7: 134006235 - 134006331
Public Clones (sanger) (sanger) (sanger) IST13351A6 (tigm) IST10046D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000384940 (Chr7:134006114..134006234 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGAAGCAGGCGTTGAAG Chr7:134006182..134006201 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000384940 (Chr7:134006114..134006234 +)
Downstram Exon
ENSMUSE00000339006 (Chr7:134006332..134006440 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGAAGCAGGCGTTGAAG Chr7:134006182..134006201 59.76 50 GGAGCAGGAGACCTCTTCACT Chr7:134006395..134006415 60.01 57.14

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339090 Chr7:134005953..134006030 CGAAAATTCACTCGCAGCTT Chr7:134005987..134006006 60.52 45
upstream ENSMUSE00000384940 Chr7:134006114..134006234 AAGAGAAGCAGGCGTTGAAG Chr7:134006182..134006201 59.76 50

*** Putative Vector Insertion (Chr 7: 134006235 - 134006331) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000339006 Chr7:134006332..134006440 GGAGCAGGAGACCTCTTCACT Chr7:134006395..134006415 60.01 57.14
downstream ENSMUSE00000369751 Chr7:134006683..134007764 CTCCTCCTGGCAGTTAGCAC Chr7:134007080..134007099 60.01 60
downstream ENSMUSE00000292742 Chr7:134007834..134007999 CACCACAGGCTCGAATGTAA Chr7:134007906..134007925 59.72 50
downstream ENSMUSE00000292736 Chr7:134008077..134008175 GCGACACTTCTCCAAGGAAG Chr7:134008105..134008124 59.99 55
downstream ENSMUSE00000361296 Chr7:134008248..134008636 CTGTCACCGTCACTGCTGAT Chr7:134008407..134008426 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000042606