Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35539
Trapped Gene
Atad1 (ENSMUSG00000013662)
Vector Insertion
Chr 19: 32770281 - 32773131
Public Clones IST10894C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145927 (Chr19:32772930..32773130 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145927 (Chr19:32772930..32773130 -)
Downstram Exon
ENSMUSE00000145926 (Chr19:32770282..32770388 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388512 Chr19:32786756..32786812 No primer for this exon
upstream ENSMUSE00000272067 Chr19:32781325..32781499 No primer for this exon
upstream ENSMUSE00000449883 Chr19:32777030..32777128 No primer for this exon
upstream ENSMUSE00000145936 Chr19:32776010..32776130 No primer for this exon
upstream ENSMUSE00000145927 Chr19:32772930..32773130 No primer for this exon
upstream ENSMUSE00000145926 Chr19:32770282..32770388 No primer for this exon

*** Putative Vector Insertion (Chr 19: 32770281 - 32773131) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145934 Chr19:32761723..32761812 No primer for this exon
downstream ENSMUSE00000145945 Chr19:32758492..32758542 No primer for this exon
downstream ENSMUSE00000145943 Chr19:32751207..32751340 No primer for this exon
downstream ENSMUSE00000449864 Chr19:32747050..32748854 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr19:32773061..32773081 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAATTGCCAACGTGACTGG Chr19:32773071..32773091 59.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013662