Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35564
Trapped Gene
Cbln3 (ENSMUSG00000040380)
Vector Insertion
Chr 14: 56497756 - 56502424
Public Clones IST14893G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342231 (Chr14:56502304..56502423 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCCACGTGGTCAAGGTGT Chr14:56502324..56502343 60.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342231 (Chr14:56502304..56502423 -)
Downstram Exon
ENSMUSE00000513239 (Chr14:56497757..56502014 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCCACGTGGTCAAGGTGT Chr14:56502324..56502343 60.28 50 TCATGCGTATTAGCGTCTGC Chr14:56500184..56500203 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000509592 Chr14:56502749..56503093 ACCATGAACCAGCAGGAGAA Chr14:56502788..56502807 60.66 50
upstream ENSMUSE00000342231 Chr14:56502304..56502423 ATTCCACGTGGTCAAGGTGT Chr14:56502324..56502343 60.28 50
upstream ENSMUSE00000513239 Chr14:56497757..56502014 TCAGCGCTATTTGGTGACAG Chr14:56501471..56501490 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCCATCACATCCAAAAT Chr14:56499411..56499431 60.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGCCATCACATCCAAAAT Chr14:56499411..56499431 60.72 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040380