Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35572
Trapped Gene
Slc6a11 (ENSMUSG00000030307)
Vector Insertion
Chr 6: 114112168 - 114144604
Public Clones IST14404C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197305 (Chr6:114112035..114112167 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTATATCCGATGGCATT Chr6:114112046..114112065 60.28 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197305 (Chr6:114112035..114112167 +)
Downstram Exon
ENSMUSE00000197304 (Chr6:114144605..114144739 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTATATCCGATGGCATT Chr6:114112046..114112065 60.28 45 GATGTAGGGGAAGGTTGCAG Chr6:114144640..114144659 59.55 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406940 Chr6:114081235..114081511 CAAGGTGGAGTTCGTGTTGA Chr6:114081420..114081439 59.72 50
upstream ENSMUSE00000197306 Chr6:114084593..114084727 TTTTTCATCTGCTGCGGAAT Chr6:114084619..114084638 60.72 40
upstream ENSMUSE00000197295 Chr6:114084844..114084984 CGTGGGCCATCTTCTACCTA Chr6:114084907..114084926 60.09 55
upstream ENSMUSE00000197293 Chr6:114088895..114088985 TGTGGAGTTCCAGAAGCTGA Chr6:114088902..114088921 59.54 50
upstream ENSMUSE00000197305 Chr6:114112035..114112167 TGGCTATATCCGATGGCATT Chr6:114112046..114112065 60.28 45

*** Putative Vector Insertion (Chr 6: 114112168 - 114144604) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197304 Chr6:114144605..114144739 GATGTAGGGGAAGGTTGCAG Chr6:114144640..114144659 59.55 55
downstream ENSMUSE00000459748 Chr6:114175817..114175920 TAACTCCCCAGAGCGGTTAG Chr6:114175896..114175915 59.33 55
downstream ENSMUSE00000555666 Chr6:114180031..114180155 ATGAAGCCCAGGACTGAGAA Chr6:114180114..114180133 59.8 50
downstream ENSMUSE00000459738 Chr6:114185794..114185906 GTAGGCGATGAAAGCCAGTC Chr6:114185822..114185841 59.84 55
downstream ENSMUSE00000459734 Chr6:114188353..114188490 CTACCACGGCTGTCACAAGA Chr6:114188392..114188411 59.9 55
downstream ENSMUSE00000555659 Chr6:114193860..114193962 AGATGGCCACAAAGAGCAAG Chr6:114193935..114193954 60.4 50
downstream ENSMUSE00000459725 Chr6:114194804..114194904 TTCCAGCACCACTTGATGAG Chr6:114194882..114194901 59.83 50
downstream ENSMUSE00000459721 Chr6:114195600..114195770 GTAGCCCCAAGCAGGATATG Chr6:114195680..114195699 59.55 55
downstream ENSMUSE00000385404 Chr6:114197582..114199880 ACCTCTGCTCTTCGTTTCCA Chr6:114198988..114199007 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATCGGGTAGTCTGTGCTG Chr6:114130157..114130177 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr6:114121215..114121235 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030307