Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35582
Trapped Gene
Tsen15 (ENSMUSG00000014980)
Vector Insertion
Chr 1: 154230828 - 154233771
Public Clones IST10047B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000364363 (Chr1:154233589..154233770 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000364363 (Chr1:154233589..154233770 -)
Downstram Exon
ENSMUSE00000159633 (Chr1:154230829..154230910 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AACTTGGGTGGCATCTCCTAT Chr1:154230844..154230864 59.84 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000364363 Chr1:154233589..154233770 No primer for this exon
upstream ENSMUSE00000159633 Chr1:154230829..154230910 TAGGAGATGCCACCCAAGTT Chr1:154230866..154230885 59.55 50

*** Putative Vector Insertion (Chr 1: 154230828 - 154233771) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000159632 Chr1:154230392..154230527 GAAATGGGTGTAGGCACCAC Chr1:154230391..154230410 60.24 55
downstream ENSMUSE00000159635 Chr1:154218884..154219025 AAAGACATCGGCAGTTCTGG Chr1:154218941..154218960 60.26 50
downstream ENSMUSE00000379420 Chr1:154217886..154218413 GCCTGCCATCCTACTGAGAC Chr1:154217935..154217954 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr1:154233700..154233720 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000014980