Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35583
Trapped Gene
C230021P08Rik (ENSMUSG00000023009)
Vector Insertion
Chr 15: 99252465 - 99253710
Public Clones IST13668H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132658 (Chr15:99253567..99253709 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAACTGGAGGGACTGCCTA Chr15:99253578..99253597 59.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132658 (Chr15:99253567..99253709 -)
Downstram Exon
ENSMUSE00000508349 (Chr15:99252466..99253339 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAACTGGAGGGACTGCCTA Chr15:99253578..99253597 59.72 55 TCCCGTAGAGCAGAGCCTTA Chr15:99252859..99252878 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000550868 Chr15:99288063..99288179 AGTCGAGCTCAGCACCTGAT Chr15:99288067..99288086 60.17 55
upstream ENSMUSE00000550865 Chr15:99266458..99266518 AGCCTGGTGAGGAACAGAGA Chr15:99266462..99266481 59.99 55
upstream ENSMUSE00000550864 Chr15:99264471..99264620 CTCATTCCCAGAGCCTGACT Chr15:99264591..99264610 59.4 55
upstream ENSMUSE00000550862 Chr15:99264001..99264069 GAGAACCAGCGGGAGACTTA Chr15:99264020..99264039 59.43 55
upstream ENSMUSE00000550860 Chr15:99263876..99263914 No primer for this exon
upstream ENSMUSE00000550858 Chr15:99263136..99263255 ACTACAGCTCACGGCCAACT Chr15:99263147..99263166 59.94 55
upstream ENSMUSE00000550856 Chr15:99259785..99259898 CCATCAGAACGACCAACCTC Chr15:99259855..99259874 60.51 55
upstream ENSMUSE00000397197 Chr15:99255984..99258598 AGGTGATGAAGGGCATTGAG Chr15:99256400..99256419 60.07 50
upstream ENSMUSE00000132655 Chr15:99254549..99254708 No primer for this exon
upstream ENSMUSE00000132653 Chr15:99254384..99254465 GGAAGAGATGCCCTCTGAAG Chr15:99254423..99254442 58.97 55
upstream ENSMUSE00000132656 Chr15:99253797..99254105 GCTCCTTGACTCGAACCTTG Chr15:99254080..99254099 59.99 55
upstream ENSMUSE00000132658 Chr15:99253567..99253709 ACAACTGGAGGGACTGCCTA Chr15:99253578..99253597 59.72 55
upstream ENSMUSE00000508349 Chr15:99252466..99253339 CCGTAGACCGAAAACAGAGC Chr15:99253313..99253332 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGCTGGCCAAGAATAAT Chr15:99253655..99253675 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTGGACAGATCCCTGTGA Chr15:99253698..99253718 59.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023009