Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35612
Trapped Gene
1110057K04Rik (ENSMUSG00000037669)
Vector Insertion
Chr 12: 8245422 - 8275169
Public Clones IST14870D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000427487 (Chr12:8245249..8245421 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACGTGATGAAGCGAGTC Chr12:8245390..8245409 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000427487 (Chr12:8245249..8245421 +)
Downstram Exon
ENSMUSE00000656104 (Chr12:8275170..8275404 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACGTGATGAAGCGAGTC Chr12:8245390..8245409 59.99 50 CAGGTATCGAAACTGGCACA Chr12:8275271..8275290 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000396424 Chr12:8214929..8214998 No primer for this exon
upstream ENSMUSE00000709366 Chr12:8227406..8227561 AGACGTCAGCAAGCCAAAAC Chr12:8227521..8227540 60.44 50
upstream ENSMUSE00000720526 Chr12:8227406..8227561 AGACGTCAGCAAGCCAAAAC Chr12:8227521..8227540 60.44 50
upstream ENSMUSE00000399474 Chr12:8234026..8234169 CCAGGCTATTCCGCATTCTA Chr12:8234031..8234050 60.19 50
upstream ENSMUSE00000686781 Chr12:8234026..8234169 CCAGGCTATTCCGCATTCTA Chr12:8234031..8234050 60.19 50
upstream ENSMUSE00000427487 Chr12:8245249..8245421 TTCACGTGATGAAGCGAGTC Chr12:8245390..8245409 59.99 50
upstream ENSMUSE00000686780 Chr12:8245249..8245421 TTCACGTGATGAAGCGAGTC Chr12:8245390..8245409 59.99 50

*** Putative Vector Insertion (Chr 12: 8245422 - 8275169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000237629 Chr12:8275170..8275404 CAGGTATCGAAACTGGCACA Chr12:8275271..8275290 59.72 50
downstream ENSMUSE00000656104 Chr12:8275170..8275404 CAGGTATCGAAACTGGCACA Chr12:8275271..8275290 59.72 50
downstream ENSMUSE00000237621 Chr12:8282614..8282696 No primer for this exon
downstream ENSMUSE00000656102 Chr12:8288131..8288154 TCACGGCAGTGTAGAATTTCC Chr12:8288156..8288176 60.12 47.62
downstream ENSMUSE00000427502 Chr12:8290706..8292558 ACCTATTTTCTGGGCGGTCT Chr12:8290902..8290921 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGTGGATGACCAGGCAATA Chr12:8254454..8254475 59.56 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTGTCGATTCTGATTGCAT Chr12:8254374..8254394 59.68 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037669