Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35617
Trapped Gene
Ttc16 (ENSMUSG00000039021)
Vector Insertion
Chr 2: 32612545 - 32618526
Public Clones IST13505F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000504869 (Chr2:32617698..32618525 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCAACAGATCCCAGGAGA Chr2:32617889..32617908 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000504869 (Chr2:32617698..32618525 -)
Downstram Exon
ENSMUSE00000645822 (Chr2:32612546..32613088 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCAACAGATCCCAGGAGA Chr2:32617889..32617908 60.05 55 CGCTAGTTACCCGTGACCAT Chr2:32612567..32612586 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694866 Chr2:32630851..32630868 No primer for this exon
upstream ENSMUSE00000440206 Chr2:32630756..32630859 TGAGGAAGAGCCAGTCAAGC Chr2:32630777..32630796 60.68 55
upstream ENSMUSE00000645833 Chr2:32630568..32630615 No primer for this exon
upstream ENSMUSE00000440199 Chr2:32630314..32630615 AGCAGGGTCTGAAAACGATG Chr2:32630331..32630350 60.26 50
upstream ENSMUSE00000603931 Chr2:32629911..32630077 TCTTTGGGACCAGTCATGTG Chr2:32629982..32630001 59.52 50
upstream ENSMUSE00000603935 Chr2:32629911..32630077 TCTTTGGGACCAGTCATGTG Chr2:32629982..32630001 59.52 50
upstream ENSMUSE00000273549 Chr2:32629502..32629592 ATAACCAAGGCCATCAGTGC Chr2:32629571..32629590 59.96 50
upstream ENSMUSE00000273546 Chr2:32629185..32629328 CTGAGGCCTTCATCCAACTC Chr2:32629287..32629306 59.8 55
upstream ENSMUSE00000273542 Chr2:32627630..32627730 AACGCTTCCTTCAGTTACCG Chr2:32627633..32627652 59.38 50
upstream ENSMUSE00000273535 Chr2:32627409..32627538 CCTCAAGCGGTATCACGACT Chr2:32627501..32627520 60.28 55
upstream ENSMUSE00000273528 Chr2:32625572..32625786 TGTGCCATTGAGAACAATCC Chr2:32625599..32625618 59.5 45
upstream ENSMUSE00000273521 Chr2:32624618..32624862 TTTGACCATGCTGTGGAAGA Chr2:32624815..32624834 60.24 45
upstream ENSMUSE00000273510 Chr2:32624362..32624503 CTGGATGAAGGAGCCAACTT Chr2:32624413..32624432 59.28 50
upstream ENSMUSE00000645826 Chr2:32623457..32623622 TCAATCCCGAGTATCCCAAG Chr2:32623457..32623476 59.89 50
upstream ENSMUSE00000645824 Chr2:32622993..32623135 TGATAGAAAATGGGCCGAAG Chr2:32623019..32623038 60.03 45
upstream ENSMUSE00000645823 Chr2:32622698..32622821 GGTTATTGGAACGCAGGAAA Chr2:32622797..32622816 59.94 45
upstream ENSMUSE00000273467 Chr2:32620413..32620488 CTCCTCAGGCTCCGTCTTTA Chr2:32620416..32620435 59.57 55
upstream ENSMUSE00000504869 Chr2:32617698..32618525 GTCCAACAGATCCCAGGAGA Chr2:32617889..32617908 60.05 55
upstream ENSMUSE00000645822 Chr2:32612546..32613088 AGAAGTCGCATTCGCAGAAC Chr2:32612936..32612955 60.55 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGAGTGATAATCGCCTTGC Chr2:32615531..32615553 59.88 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGAAGGGCTTTGAGAATG Chr2:32615550..32615570 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039021