Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3563
Trapped Gene
Dcp1b (ENSMUSG00000041477)
Vector Insertion
Chr 6: 119125270 - 119125461
Public Clones AY0868 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693169 (Chr6:119125271..119125460 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCCTACATCAGTCGCATC Chr6:119125384..119125403 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693169 (Chr6:119125271..119125460 +)
Downstram Exon
ENSMUSE00000352945 (Chr6:119125306..119125460 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCCTACATCAGTCGCATC Chr6:119125384..119125403 59.96 55 CCACGATGCGACTGATGTAG Chr6:119125410..119125429 60.29 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 6: 119125270 - 119125461) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693169 Chr6:119125271..119125460 CCACGATGCGACTGATGTAG Chr6:119125410..119125429 60.29 55
downstream ENSMUSE00000352945 Chr6:119125306..119125460 CCACGATGCGACTGATGTAG Chr6:119125410..119125429 60.29 55
downstream ENSMUSE00000388656 Chr6:119130083..119130123 AACAAACAAGGTTCCCTCCA Chr6:119130118..119130137 59.42 45
downstream ENSMUSE00000339718 Chr6:119133668..119133795 TTCCATGCTGAGCCTATTCA Chr6:119133722..119133741 59.38 45
downstream ENSMUSE00000517543 Chr6:119148946..119149012 TTGCAATTCTCTGGCACTCTT Chr6:119149001..119149021 60.01 42.86
downstream ENSMUSE00000466787 Chr6:119150840..119150969 GGCTTTCAACTGTTCGCTCT Chr6:119150870..119150889 59.62 50
downstream ENSMUSE00000515737 Chr6:119156488..119156616 TGGCTCGGAACAGGTCTTAC Chr6:119156511..119156530 60.26 55
downstream ENSMUSE00000372507 Chr6:119164788..119165624 TAGGCGCACAGGGGTTATAC Chr6:119165265..119165284 59.98 55
downstream ENSMUSE00000693134 Chr6:119167821..119167997 GCCATGAGCCCATTATCAGT Chr6:119167867..119167886 59.92 50
downstream ENSMUSE00000651931 Chr6:119167920..119167997 No primer for this exon
downstream ENSMUSE00000553994 Chr6:119170021..119170224 TGGTTACGTGGTTCTCATGG Chr6:119170104..119170123 59.42 50
downstream ENSMUSE00000693123 Chr6:119170021..119170203 TGGTTACGTGGTTCTCATGG Chr6:119170104..119170123 59.42 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr6:119125321..119125341 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000041477