Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35643
Trapped Gene
AL805966.7 (ENSMUSG00000073991)
Vector Insertion
Chr 4: 18834142 - 18982297
Public Clones IST11180F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633338 (Chr4:18982141..18982296 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGGCCCTTCTATTGATGA Chr4:18982195..18982214 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633338 (Chr4:18982141..18982296 -)
Downstram Exon
ENSMUSE00000633348 (Chr4:18834143..18834288 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGGCCCTTCTATTGATGA Chr4:18982195..18982214 59.89 50 CTGCAAAATCTTCCACACCA Chr4:18834215..18834234 59.69 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633341 Chr4:19049546..19049633 TTAGCAATGTGCCTCCTCCT Chr4:19049565..19049584 59.84 50
upstream ENSMUSE00000633340 Chr4:19030450..19030522 GCCTGAGACTGAGCAAAACC Chr4:19030503..19030522 60 55
upstream ENSMUSE00000633339 Chr4:19025291..19025404 TCCTGCGTGAAAAGACAGTG Chr4:19025323..19025342 60.03 50
upstream ENSMUSE00000633338 Chr4:18982141..18982296 GGTGGCCCTTCTATTGATGA Chr4:18982195..18982214 59.89 50
upstream ENSMUSE00000633348 Chr4:18834143..18834288 CCTGGATCAAAGGTAGCACAG Chr4:18834143..18834163 59.74 52.38

*** Putative Vector Insertion (Chr 4: 18834142 - 18982297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000633347 Chr4:18822123..18822310 CTGGCCCGTCAGTAAGACAT Chr4:18822248..18822267 60.13 55
downstream ENSMUSE00000633346 Chr4:18814763..18814894 AACGGTCACGTTCATCCATT Chr4:18814809..18814828 60.24 45
downstream ENSMUSE00000633345 Chr4:18813135..18813267 AAAAAGGACACTTGCGGATT Chr4:18813188..18813207 58.69 40
downstream ENSMUSE00000633344 Chr4:18789196..18789305 TGGTAGGTCCACAAGTCCAAC Chr4:18789186..18789206 59.88 52.38
downstream ENSMUSE00000633343 Chr4:18787602..18787751 GCCATCTCAACTTCTTGTCCA Chr4:18787605..18787625 60.25 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTCACCTTTGGCAGTGT Chr4:18892249..18892269 60.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTACGTGACTGGGAAAACC Chr4:18892230..18892251 58.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073991