Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35644
Trapped Gene
Rad54l2 (ENSMUSG00000040661)
Vector Insertion
Chr 9: 106590412 - 106598296
Public Clones IST13645B9 (tigm) IST10497H9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259556 (Chr9:106598203..106598295 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATACATCCGCACCAGTGA Chr9:106598274..106598293 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259556 (Chr9:106598203..106598295 -)
Downstram Exon
ENSMUSE00000335378 (Chr9:106590413..106596041 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATACATCCGCACCAGTGA Chr9:106598274..106598293 59.99 50 GCAGGGGCTTCCTAGCTACT Chr9:106595010..106595029 60 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000470174 Chr9:106691311..106691544 CGCAGACACTGTCCAAGAGG Chr9:106691378..106691397 62.03 60
upstream ENSMUSE00000419570 Chr9:106656276..106656469 AGTCGGTAATGCCCACTGAG Chr9:106656432..106656451 60.13 55
upstream ENSMUSE00000355096 Chr9:106625047..106625245 GCGGTGCACTTCAACTACCT Chr9:106625159..106625178 60.32 55
upstream ENSMUSE00000419551 Chr9:106622656..106622795 TACTCCGGGAGGATCAGTTG Chr9:106622771..106622790 60.06 55
upstream ENSMUSE00000419547 Chr9:106621939..106622055 TAGTGATGGTCCCCAACTCC Chr9:106622017..106622036 59.78 55
upstream ENSMUSE00000419544 Chr9:106621244..106621470 GAGAGGAGGATACGCTGCAC Chr9:106621430..106621449 59.98 60
upstream ENSMUSE00000259840 Chr9:106620080..106620262 ATACGCCAGCCAAAACAGTC Chr9:106620095..106620114 60.14 50
upstream ENSMUSE00000259825 Chr9:106619517..106619650 AAGTCCAGCCTCGGTTCTTT Chr9:106619546..106619565 60.25 50
upstream ENSMUSE00000259806 Chr9:106618392..106618588 GCTCTCATCCCGTCATCATT Chr9:106618432..106618451 60.04 50
upstream ENSMUSE00000259794 Chr9:106615575..106615917 CATGTTTGAACGCCCTATCC Chr9:106615672..106615691 60.33 50
upstream ENSMUSE00000259770 Chr9:106614663..106614840 ACAATTCATGGACCGTTTCC Chr9:106614728..106614747 59.65 45
upstream ENSMUSE00000259750 Chr9:106612999..106613250 CCTAGCCAATGAGCAAGACC Chr9:106613184..106613203 59.84 55
upstream ENSMUSE00000259735 Chr9:106612665..106612783 CCTGATTGAAGAAAGCGTGA Chr9:106612693..106612712 59 45
upstream ENSMUSE00000259714 Chr9:106610546..106610664 AGTGGGTTCGAAATGTCAGC Chr9:106610553..106610572 60.12 50
upstream ENSMUSE00000259686 Chr9:106608099..106608198 TCAGTTCAATGATCCCAGCA Chr9:106608133..106608152 60.2 45
upstream ENSMUSE00000259673 Chr9:106606396..106606601 CCAGGCAGTATGTCGGGTAT Chr9:106606501..106606520 59.84 55
upstream ENSMUSE00000259654 Chr9:106605823..106605995 CTGCCTGAAGTACCCTCACC Chr9:106605834..106605853 59.72 60
upstream ENSMUSE00000259625 Chr9:106604976..106605172 TTTTGAGCACGAGTCATTGC Chr9:106605148..106605167 59.99 45
upstream ENSMUSE00000259606 Chr9:106602826..106603025 CTGTACAGTCCACCCCCATT Chr9:106602959..106602978 59.7 55
upstream ENSMUSE00000259587 Chr9:106600449..106600538 TGGACTCAACAGCTCCACAG Chr9:106600506..106600525 60.02 55
upstream ENSMUSE00000259556 Chr9:106598203..106598295 ACATACATCCGCACCAGTGA Chr9:106598274..106598293 59.99 50
upstream ENSMUSE00000335378 Chr9:106590413..106596041 CCGTGTGTGTGTGTGTGTGT Chr9:106594567..106594586 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGTGATGGACGCATCTT Chr9:106595260..106595280 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAGTGATGGACGCATCTT Chr9:106595260..106595280 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040661