Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35645
Trapped Gene
Gadl1 (ENSMUSG00000056880)
Vector Insertion
Chr 9: 115950335 - 115983057
Public Clones IST14318E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717415 (Chr9:115950021..115950334 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGCCGAGGATTCCTTTT Chr9:115950036..115950055 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717415 (Chr9:115950021..115950334 +)
Downstram Exon
ENSMUSE00000453869 (Chr9:115983058..115983231 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGCCGAGGATTCCTTTT Chr9:115950036..115950055 60.04 45 ACTTGAGGGCTGATGACCAC Chr9:115983173..115983192 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714498 Chr9:115818573..115818632 GCAGGAAGGAACCTTGTTCA Chr9:115818583..115818602 60.23 50
upstream ENSMUSE00000716204 Chr9:115818573..115818632 GCAGGAAGGAACCTTGTTCA Chr9:115818583..115818602 60.23 50
upstream ENSMUSE00000528640 Chr9:115846260..115846432 AGAAGGAGATGACCCCTGGT Chr9:115846272..115846291 59.93 55
upstream ENSMUSE00000688983 Chr9:115846260..115846432 AGAAGGAGATGACCCCTGGT Chr9:115846272..115846291 59.93 55
upstream ENSMUSE00000712594 Chr9:115846260..115846432 AGAAGGAGATGACCCCTGGT Chr9:115846272..115846291 59.93 55
upstream ENSMUSE00000528638 Chr9:115850392..115850518 CATCCACTTCAGCGTCAAAA Chr9:115850496..115850515 59.84 45
upstream ENSMUSE00000688982 Chr9:115850392..115850518 CATCCACTTCAGCGTCAAAA Chr9:115850496..115850515 59.84 45
upstream ENSMUSE00000528637 Chr9:115853290..115853380 ATAACAGAGGCGCTGAATCC Chr9:115853355..115853374 59.3 50
upstream ENSMUSE00000688980 Chr9:115853290..115853380 ATAACAGAGGCGCTGAATCC Chr9:115853355..115853374 59.3 50
upstream ENSMUSE00000528636 Chr9:115857777..115857883 AGGTGTCCCCAGTGTTTCTG Chr9:115857788..115857807 60 55
upstream ENSMUSE00000688979 Chr9:115857777..115857883 AGGTGTCCCCAGTGTTTCTG Chr9:115857788..115857807 60 55
upstream ENSMUSE00000528635 Chr9:115858616..115858731 CCTGTCTGGTTTGCCAAGAT Chr9:115858689..115858708 60.11 50
upstream ENSMUSE00000688978 Chr9:115858616..115858731 CCTGTCTGGTTTGCCAAGAT Chr9:115858689..115858708 60.11 50
upstream ENSMUSE00000528633 Chr9:115863690..115863769 GATTGGCACTCAGAACGTGT Chr9:115863728..115863747 58.73 50
upstream ENSMUSE00000688976 Chr9:115863690..115863769 GATTGGCACTCAGAACGTGT Chr9:115863728..115863747 58.73 50
upstream ENSMUSE00000528632 Chr9:115863901..115863955 ACAAATTTGGCAAGCGAGAC Chr9:115863931..115863950 60.26 45
upstream ENSMUSE00000688973 Chr9:115863901..115863955 ACAAATTTGGCAAGCGAGAC Chr9:115863931..115863950 60.26 45
upstream ENSMUSE00000528631 Chr9:115869475..115869591 ATTGCTGAGGTCTGCGAGAG Chr9:115869547..115869566 60.7 55
upstream ENSMUSE00000528630 Chr9:115874723..115874787 GCTCAGCTTTGGTGTCAAGA Chr9:115874736..115874755 59.17 50
upstream ENSMUSE00000328209 Chr9:115875360..115875441 GAACCCACACAAGATGCTGA Chr9:115875378..115875397 59.68 50
upstream ENSMUSE00000328189 Chr9:115915617..115915816 GACACCGGAGACAAGTCCAT Chr9:115915692..115915711 59.97 55
upstream ENSMUSE00000327845 Chr9:115930898..115930949 GAAGGCTTCAAGCTGCTGAT Chr9:115930926..115930945 59.72 50
upstream ENSMUSE00000327966 Chr9:115939859..115939948 CCACCGAGTCTCAGAGAGATG Chr9:115939892..115939912 59.99 57.14
upstream ENSMUSE00000528627 Chr9:115950021..115950333 ATCTGCCGAGGATTCCTTTT Chr9:115950036..115950055 60.04 45
upstream ENSMUSE00000717415 Chr9:115950021..115950334 ATCTGCCGAGGATTCCTTTT Chr9:115950036..115950055 60.04 45

*** Putative Vector Insertion (Chr 9: 115950335 - 115983057) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453869 Chr9:115983058..115983231 ACTTGAGGGCTGATGACCAC Chr9:115983173..115983192 60.12 55
downstream ENSMUSE00000709110 Chr9:115983058..115983465 ACTTGAGGGCTGATGACCAC Chr9:115983173..115983192 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGGTTCAGTTTGGTTAATCG Chr9:115977371..115977392 59.98 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCCATCATCAACCCACA Chr9:115971366..115971386 59.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056880