Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35653
Trapped Gene
Acad9 (ENSMUSG00000027710)
Vector Insertion
Chr 3: 35965193 - 35968631
Public Clones IST14432G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000351785 (Chr3:35964990..35965192 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGTCAGGAGCAGCATGT Chr3:35965015..35965034 59.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000351785 (Chr3:35964990..35965192 +)
Downstram Exon
ENSMUSE00000389647 (Chr3:35968632..35968725 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGTCAGGAGCAGCATGT Chr3:35965015..35965034 59.58 50 GGTCCCACGAACTGATTGAT Chr3:35968702..35968721 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351785 Chr3:35964990..35965192 TGAAGTCAGGAGCAGCATGT Chr3:35965015..35965034 59.58 50

*** Putative Vector Insertion (Chr 3: 35965193 - 35968631) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389647 Chr3:35968632..35968725 GGTCCCACGAACTGATTGAT Chr3:35968702..35968721 59.79 50
downstream ENSMUSE00000377846 Chr3:35972429..35972530 CTGGGACCTGTATGCCAAAA Chr3:35972524..35972543 60.88 50
downstream ENSMUSE00000332199 Chr3:35973272..35973378 ACCGTGATAGAGGCATCCAG Chr3:35973347..35973366 60.1 55
downstream ENSMUSE00000375627 Chr3:35974165..35974265 AGACGACAGTTTGGGCAGAT Chr3:35974227..35974246 59.73 50
downstream ENSMUSE00000335247 Chr3:35974898..35974976 CGTAGCTCTGGTCTGGATGG Chr3:35974937..35974956 60.81 60
downstream ENSMUSE00000172514 Chr3:35975644..35975818 TCCGCCGAAGTCTCTTTCTA Chr3:35975772..35975791 60.09 50
downstream ENSMUSE00000268331 Chr3:35977360..35977433 CTTAAAGCCCCCTCCAACTT Chr3:35977436..35977455 59.59 50
downstream ENSMUSE00000172513 Chr3:35979143..35979218 CCCACTGTTCAGGATGTTCA Chr3:35979172..35979191 59.52 50
downstream ENSMUSE00000268319 Chr3:35980733..35980803 CCTCGTACAGGCATACTCAGC Chr3:35980763..35980783 59.91 57.14
downstream ENSMUSE00000172501 Chr3:35981031..35981150 GGTTGGTCTAGCATCCCTGA Chr3:35981113..35981132 60.07 55
downstream ENSMUSE00000172504 Chr3:35984336..35984464 CATGCGCTCATAGGGGTAGT Chr3:35984434..35984453 60.12 55
downstream ENSMUSE00000407542 Chr3:35986642..35986721 No primer for this exon
downstream ENSMUSE00000366947 Chr3:35987410..35987536 CTGTGGTCACATTGCCACTT Chr3:35987441..35987460 59.6 50
downstream ENSMUSE00000172502 Chr3:35987737..35987814 ACAGTCCGGCCAAAGTAATG Chr3:35987789..35987808 59.99 50
downstream ENSMUSE00000172503 Chr3:35988254..35988382 TTGGCTACCCGCTTTAACAC Chr3:35988297..35988316 60.13 50
downstream ENSMUSE00000172500 Chr3:35989004..35989076 CCAGCTGAGACAGGCTGAAG Chr3:35989073..35989092 61.29 60
downstream ENSMUSE00000639512 Chr3:35989753..35990379 GGATCTGCCGAGACACTTTC Chr3:35989806..35989825 59.81 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTGCTCCCACCTTTCATT Chr3:35965223..35965243 59.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTGCTCCCACCTTTCATT Chr3:35965223..35965243 59.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027710