Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35661
Trapped Gene
Ube2m (ENSMUSG00000005575)
Vector Insertion
Chr 7: 13620587 - 13621255
Public Clones IST10293A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000481905 (Chr7:13621191..13621254 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000481905 (Chr7:13621191..13621254 -)
Downstram Exon
ENSMUSE00000408154 (Chr7:13620588..13621103 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365033 Chr7:13622970..13623327 No primer for this exon
upstream ENSMUSE00000286070 Chr7:13621915..13622009 No primer for this exon
upstream ENSMUSE00000195441 Chr7:13621783..13621821 No primer for this exon
upstream ENSMUSE00000195443 Chr7:13621561..13621664 No primer for this exon
upstream ENSMUSE00000481905 Chr7:13621191..13621254 No primer for this exon
upstream ENSMUSE00000408154 Chr7:13620588..13621103 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAAGCCAGTCCTTACGAT Chr7:13621226..13621246 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAGCCAGTCCTTACGAT Chr7:13621226..13621246 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005575