Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35680
Trapped Gene
Zfp579 (ENSMUSG00000051550)
Vector Insertion
Chr 7: 4944455 - 4947634
Public Clones IST13606G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637486 (Chr7:4947606..4947633 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637486 (Chr7:4947606..4947633 -)
Downstram Exon
ENSMUSE00000677252 (Chr7:4944456..4946514 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TAAGACACGTGTTGGGGTGA Chr7:4944623..4944642 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637487 Chr7:4947635..4947655 No primer for this exon
upstream ENSMUSE00000637486 Chr7:4947606..4947633 No primer for this exon
upstream ENSMUSE00000677253 Chr7:4947606..4947703 GCAGGGAAGGAAGAAAGGAG Chr7:4947620..4947639 60.32 55
upstream ENSMUSE00000444946 Chr7:4944458..4945154 TCACCCCAACACGTGTCTTA Chr7:4944645..4944664 60 50
upstream ENSMUSE00000677252 Chr7:4944456..4946514 TCACCCCAACACGTGTCTTA Chr7:4944645..4944664 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGAGACTAATCGCCTTGC Chr7:4947571..4947591 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACCGTGACTGGGAAAAC Chr7:4947568..4947588 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051550