Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35689
Trapped Gene
Agl (ENSMUSG00000033400)
Vector Insertion
Chr 3: 116496529 - 116510336
Public Clones IST10774D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670112 (Chr3:116510186..116510335 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCCTCCAGAAGCCAAAA Chr3:116510267..116510286 59.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670112 (Chr3:116510186..116510335 -)
Downstram Exon
ENSMUSE00000670111 (Chr3:116496530..116496740 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCCTCCAGAAGCCAAAA Chr3:116510267..116510286 59.24 45 AAGTTGGGCCTAATCGGAAC Chr3:116496686..116496705 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670113 Chr3:116510946..116511084 No primer for this exon
upstream ENSMUSE00000670112 Chr3:116510186..116510335 GAATCCTCCAGAAGCCAAAA Chr3:116510267..116510286 59.24 45
upstream ENSMUSE00000670111 Chr3:116496530..116496740 GTTCCGATTAGGCCCAACTT Chr3:116496708..116496727 60.32 50

*** Putative Vector Insertion (Chr 3: 116496529 - 116510336) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000670110 Chr3:116494936..116495102 CCACTCATCGAAGGGTCCTA Chr3:116494945..116494964 60.06 55
downstream ENSMUSE00000670109 Chr3:116493924..116494127 GCTCTAACTGATCGGCAAGG Chr3:116494025..116494044 59.98 55
downstream ENSMUSE00000670108 Chr3:116491444..116491625 GTATGCAGATTCCGGGTGTT Chr3:116491560..116491579 59.82 50
downstream ENSMUSE00000670107 Chr3:116491189..116491300 TGGAAAAACTCCCAGAGTTGA Chr3:116491217..116491237 59.7 42.86
downstream ENSMUSE00000670105 Chr3:116490148..116490271 AAAAGTCGCCAGAGCAGTGT Chr3:116490137..116490156 60.06 50
downstream ENSMUSE00000670103 Chr3:116489637..116489739 CTGGTGAGGTGGTGCTTCTC Chr3:116489631..116489650 60.86 60
downstream ENSMUSE00000670100 Chr3:116489448..116489545 CCTGCCAGTCGTTCATAAAA Chr3:116489477..116489496 58.77 45
downstream ENSMUSE00000670099 Chr3:116487978..116488117 AGGAAGCACGCTTTATCTGG Chr3:116488015..116488034 59.48 50
downstream ENSMUSE00000670098 Chr3:116487371..116487558 GACGAACTCCCTGGAAGTGA Chr3:116487387..116487406 60.24 55
downstream ENSMUSE00000670097 Chr3:116485438..116485561 ATTGTCCAGCTCTTCGCTTC Chr3:116485456..116485475 59.58 50
downstream ENSMUSE00000670095 Chr3:116484506..116484669 TCGTGGGTGATGTCCATAAA Chr3:116484503..116484522 59.77 45
downstream ENSMUSE00000670093 Chr3:116484161..116484262 TGAGGCACTAGCTCGTCGTA Chr3:116484143..116484162 59.76 55
downstream ENSMUSE00000670092 Chr3:116483910..116484065 CTGCAATAATCCCGCTATGG Chr3:116483944..116483963 60.44 50
downstream ENSMUSE00000670091 Chr3:116483644..116483794 CAACAGACTGGTGGATGCTC Chr3:116483700..116483719 59.26 55
downstream ENSMUSE00000670090 Chr3:116482174..116482298 GGCATTCCATTGATCGAGTT Chr3:116482186..116482205 59.9 45
downstream ENSMUSE00000670089 Chr3:116481973..116482085 ATTCATTGGGACCCTTTGTG Chr3:116482006..116482025 59.65 45
downstream ENSMUSE00000670088 Chr3:116481537..116481671 TCAGGTGGTTCCGAAGAATC Chr3:116481594..116481613 60.05 50
downstream ENSMUSE00000670087 Chr3:116479447..116479577 GCCACCGTCTTCTTGTTCTT Chr3:116479477..116479496 59.33 50
downstream ENSMUSE00000670086 Chr3:116475682..116475818 AAATAAGCCGACCACTCACG Chr3:116475683..116475702 60.13 50
downstream ENSMUSE00000670085 Chr3:116475305..116475438 ATGAGGTAGCGTGGGATCTG Chr3:116475358..116475377 60.1 55
downstream ENSMUSE00000670084 Chr3:116474258..116474433 ATTTCCCGACTCCACACATC Chr3:116474338..116474357 59.79 50
downstream ENSMUSE00000670083 Chr3:116471704..116471806 CCAGGTAGCGTCCAGTAACC Chr3:116471689..116471708 59.62 60
downstream ENSMUSE00000670082 Chr3:116461609..116461834 CCGAGGAGGTTAGGGATGAG Chr3:116461753..116461772 60.97 60
downstream ENSMUSE00000323476 Chr3:116461157..116461268 CATGTTTCGGTCGATCTGTG Chr3:116461145..116461164 60.11 50
downstream ENSMUSE00000323471 Chr3:116457791..116457926 TCATCAATCCCCGCAGTTAT Chr3:116457877..116457896 60.3 45
downstream ENSMUSE00000323461 Chr3:116456169..116456281 AATTCCAGCAACCAACGAAC Chr3:116456197..116456216 59.98 45
downstream ENSMUSE00000323364 Chr3:116454903..116455114 TCGTACGAGACTGCCACAAC Chr3:116455068..116455087 59.9 55
downstream ENSMUSE00000323448 Chr3:116453316..116453413 AAGGGGACCAAGCAATTTTT Chr3:116453317..116453336 59.81 40
downstream ENSMUSE00000323446 Chr3:116449535..116449622 No primer for this exon
downstream ENSMUSE00000323438 Chr3:116449298..116449431 GCAGTCTCTGGACCCATCAT Chr3:116449336..116449355 60.08 55
downstream ENSMUSE00000337361 Chr3:116442917..116447853 AGTAATGTGAAGGCGGTTGG Chr3:116443257..116443276 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTAATCGCCTTGCAGCAC Chr3:116501268..116501288 61.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTTTCGTGACTGGGAAA Chr3:116501272..116501292 58.41 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033400