Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35701
Trapped Gene
C1qtnf7 (ENSMUSG00000061535)
Vector Insertion
Chr 5: 44000538 - 44006858
Public Clones IST10804G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709536 (Chr5:44000292..44000537 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAAGATGATTGTCCTGCT Chr5:44000294..44000313 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709536 (Chr5:44000292..44000537 +)
Downstram Exon
ENSMUSE00000718152 (Chr5:44006859..44007825 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAAGATGATTGTCCTGCT Chr5:44000294..44000313 60.07 50 TGGCTGCAGGTAGATGACTG Chr5:44007346..44007365 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653692 Chr5:43906827..43907225 AGACGGTTGCAGAACTTCGT Chr5:43907007..43907026 59.91 50
upstream ENSMUSE00000710498 Chr5:43993161..43993221 GAATCCTGCAGCAACCTACC Chr5:43993189..43993208 59.7 55
upstream ENSMUSE00000487218 Chr5:44000292..44000537 CCCAAGATGATTGTCCTGCT Chr5:44000294..44000313 60.07 50
upstream ENSMUSE00000709536 Chr5:44000292..44000537 CCCAAGATGATTGTCCTGCT Chr5:44000294..44000313 60.07 50

*** Putative Vector Insertion (Chr 5: 44000538 - 44006858) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599861 Chr5:44006859..44010038 TGGCTGCAGGTAGATGACTG Chr5:44007346..44007365 60.01 55
downstream ENSMUSE00000718152 Chr5:44006859..44007825 TGGCTGCAGGTAGATGACTG Chr5:44007346..44007365 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTCTGCCCGAGACTCATT Chr5:44006526..44006546 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCCGTGACTGGGAAAACC Chr5:44006585..44006605 61.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061535