Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35719
Trapped Gene
Ikbkg (ENSMUSG00000004221)
Vector Insertion
Chr X: 71675161 - 71678143
Public Clones IST15052H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000450148 (ChrX:71675043..71675160 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACCGCCTGACTAGGACTT ChrX:71675062..71675081 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000450148 (ChrX:71675043..71675160 +)
Downstram Exon
ENSMUSE00000551182 (ChrX:71678144..71678345 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACCGCCTGACTAGGACTT ChrX:71675062..71675081 59.87 55 TGCTTGTTCATCCAACAGGA ChrX:71678172..71678191 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698222 ChrX:71669943..71670054 GCTCTCCTTGTTTTGGCTCA ChrX:71669986..71670005 60.52 50
upstream ENSMUSE00000450177 ChrX:71669951..71670054 GCTCTCCTTGTTTTGGCTCA ChrX:71669986..71670005 60.52 50
upstream ENSMUSE00000698221 ChrX:71673101..71673213 TGCTTTAGCACCTGTGATGG ChrX:71673124..71673143 59.86 50
upstream ENSMUSE00000716518 ChrX:71673101..71673241 TGCTTTAGCACCTGTGATGG ChrX:71673124..71673143 59.86 50
upstream ENSMUSE00000720217 ChrX:71673101..71673241 TGCTTTAGCACCTGTGATGG ChrX:71673124..71673143 59.86 50
upstream ENSMUSE00000698232 ChrX:71674696..71674716 No primer for this exon
upstream ENSMUSE00000698219 ChrX:71675010..71675160 TGACCGCCTGACTAGGACTT ChrX:71675062..71675081 59.87 55
upstream ENSMUSE00000450148 ChrX:71675043..71675160 TGACCGCCTGACTAGGACTT ChrX:71675062..71675081 59.87 55

*** Putative Vector Insertion (Chr X: 71675161 - 71678143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209243 ChrX:71678144..71678345 TGCTTGTTCATCCAACAGGA ChrX:71678172..71678191 60.24 45
downstream ENSMUSE00000551182 ChrX:71678144..71678345 TGCTTGTTCATCCAACAGGA ChrX:71678172..71678191 60.24 45
downstream ENSMUSE00000209248 ChrX:71679142..71679353 TTAAGGCCTGTTCCCTCTGA ChrX:71679324..71679343 59.81 50
downstream ENSMUSE00000209244 ChrX:71682503..71682621 CTAAAGCTTGCCGATCCTTG ChrX:71682617..71682636 59.97 50
downstream ENSMUSE00000623413 ChrX:71682506..71682621 CTAAAGCTTGCCGATCCTTG ChrX:71682617..71682636 59.97 50
downstream ENSMUSE00000209240 ChrX:71684246..71684398 CACGCTCTGGTTCTGCATAC ChrX:71684357..71684376 59.47 55
downstream ENSMUSE00000209246 ChrX:71685214..71685289 TGTGGCTGTCGTAGTCTTGG ChrX:71685278..71685297 59.9 55
downstream ENSMUSE00000711106 ChrX:71688684..71688827 GACTGGCACAGTCTCCATCA ChrX:71688818..71688837 59.83 55
downstream ENSMUSE00000718599 ChrX:71688684..71688827 GACTGGCACAGTCTCCATCA ChrX:71688818..71688837 59.83 55
downstream ENSMUSE00000209247 ChrX:71689111..71689253 GCTGCTCCTGCAAATACTCC ChrX:71689198..71689217 59.99 55
downstream ENSMUSE00000698226 ChrX:71689111..71689253 GCTGCTCCTGCAAATACTCC ChrX:71689198..71689217 59.99 55
downstream ENSMUSE00000209245 ChrX:71693198..71693259 ACATGCCGCTTCCTCATATC ChrX:71693227..71693246 60.07 50
downstream ENSMUSE00000698225 ChrX:71693198..71693259 ACATGCCGCTTCCTCATATC ChrX:71693227..71693246 60.07 50
downstream ENSMUSE00000388445 ChrX:71693556..71694444 GTTCACCGGCAAGAAAGGTA ChrX:71694018..71694037 60.11 50
downstream ENSMUSE00000450101 ChrX:71693556..71696859 TCTTGACCAGTGCATGAAGC ChrX:71696032..71696051 59.99 50
downstream ENSMUSE00000698218 ChrX:71693556..71695625 AGAGCACACTGGGGCTAGAA ChrX:71694603..71694622 60.01 55
downstream ENSMUSE00000698220 ChrX:71693556..71694086 GTTCACCGGCAAGAAAGGTA ChrX:71694018..71694037 60.11 50
downstream ENSMUSE00000698224 ChrX:71693556..71694444 GTTCACCGGCAAGAAAGGTA ChrX:71694018..71694037 60.11 50
downstream ENSMUSE00000698234 ChrX:71693556..71699193 TCTTGACCAGTGCATGAAGC ChrX:71696032..71696051 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTAATCGCCTTGCAGCAC ChrX:71675142..71675162 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGCGTGACTGGGAAAACC ChrX:71675141..71675161 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004221