Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35727
Trapped Gene
Nlrp9b (ENSMUSG00000060508)
Vector Insertion
Chr 7: 20593443 - 20604520
Public Clones IST14555H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000599026 (Chr7:20593383..20593442 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGTGCAGTTGTTGCTTGA Chr7:20593388..20593407 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000599026 (Chr7:20593383..20593442 +)
Downstram Exon
ENSMUSE00000714808 (Chr7:20604521..20604791 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGTGCAGTTGTTGCTTGA Chr7:20593388..20593407 60.07 45 TCTCGATTTTCGTCCAGGAT Chr7:20604662..20604681 59.63 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000599026 Chr7:20593383..20593442 TGTGTGCAGTTGTTGCTTGA Chr7:20593388..20593407 60.07 45

*** Putative Vector Insertion (Chr 7: 20593443 - 20604520) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599025 Chr7:20604459..20604791 TCTCGATTTTCGTCCAGGAT Chr7:20604662..20604681 59.63 45
downstream ENSMUSE00000714808 Chr7:20604521..20604791 TCTCGATTTTCGTCCAGGAT Chr7:20604662..20604681 59.63 45
downstream ENSMUSE00000485568 Chr7:20608460..20610038 CCACACTGCCTTATCGGATT Chr7:20609460..20609479 59.96 50
downstream ENSMUSE00000599019 Chr7:20608460..20608718 CCCAATCCAACATTGCTTTT Chr7:20608690..20608709 59.8 40
downstream ENSMUSE00000423307 Chr7:20611865..20612029 AGGTCCTGTATGGCCCTTTT Chr7:20611969..20611988 59.83 50
downstream ENSMUSE00000486674 Chr7:20613804..20613968 CTCAGAGCAGCACACAGCTT Chr7:20613941..20613960 59.52 55
downstream ENSMUSE00000599024 Chr7:20627700..20627867 GAAATCGCAATTATGCCACA Chr7:20627753..20627772 59.53 40
downstream ENSMUSE00000599023 Chr7:20631111..20631281 CCAGGAAATTTGATCCCAGA Chr7:20631217..20631236 59.86 45
downstream ENSMUSE00000599022 Chr7:20634031..20634201 GACAGCCGAGATCTCCTCAC Chr7:20634085..20634104 59.95 60
downstream ENSMUSE00000599021 Chr7:20634773..20634943 TGGTCCAAGGTTTTCCAGTC Chr7:20634883..20634902 59.94 50
downstream ENSMUSE00000599020 Chr7:20647938..20648289 CTCGGAAAACGCAGATTTGT Chr7:20647965..20647984 60.25 45
downstream ENSMUSE00000711948 Chr7:20658520..20658655 AGCCTCTCCCCATAGAAGGA Chr7:20658642..20658661 60.17 55
downstream ENSMUSE00000721877 Chr7:20658520..20658655 AGCCTCTCCCCATAGAAGGA Chr7:20658642..20658661 60.17 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTCTTCCCTAATCGCCTTG Chr7:20593484..20593505 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGACGTGACTGGGAAAAC Chr7:20593489..20593509 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060508