Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35735
Trapped Gene
Cyp4f16 (ENSMUSG00000048440)
Vector Insertion
Chr 17: 32677361 - 32679682
Public Clones IST14174A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000547300 (Chr17:32677216..32677360 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCAGCTGGTTACCGAAAT Chr17:32677237..32677256 59.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000547300 (Chr17:32677216..32677360 +)
Downstram Exon
ENSMUSE00000547297 (Chr17:32679683..32679736 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCAGCTGGTTACCGAAAT Chr17:32677237..32677256 59.6 45 GGCTTCAGGAAGCGTAAAAA Chr17:32679731..32679750 59.47 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431018 Chr17:32673545..32673600 CAGGACTGGGGAGAAGGTCT Chr17:32673554..32673573 60.64 60
upstream ENSMUSE00000431009 Chr17:32673940..32674141 ACCTCGTCATGGCATCTTCT Chr17:32673989..32674008 59.69 50
upstream ENSMUSE00000547300 Chr17:32677216..32677360 ATGCAGCTGGTTACCGAAAT Chr17:32677237..32677256 59.6 45

*** Putative Vector Insertion (Chr 17: 32677361 - 32679682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000547297 Chr17:32679683..32679736 GGCTTCAGGAAGCGTAAAAA Chr17:32679731..32679750 59.47 45
downstream ENSMUSE00000547293 Chr17:32679822..32679949 AAGTGGAAGGCAGGTGTCAG Chr17:32679897..32679916 60.3 55
downstream ENSMUSE00000547291 Chr17:32681053..32681174 GCATTTCTGCAGACTGTCCA Chr17:32681148..32681167 59.99 50
downstream ENSMUSE00000137617 Chr17:32681828..32682098 GTGCCGTCTCTCCCTAATGA Chr17:32682011..32682030 60.22 55
downstream ENSMUSE00000547288 Chr17:32683314..32683380 CATCTGACAGCTCCTTTCCA Chr17:32683344..32683363 58.96 50
downstream ENSMUSE00000547284 Chr17:32683575..32683704 CTCGCCAGGTTGTACAGGAT Chr17:32683629..32683648 60.13 55
downstream ENSMUSE00000547282 Chr17:32687198..32687331 TGTAGCCGCAGACTCTCCTT Chr17:32687260..32687279 60.16 55
downstream ENSMUSE00000547280 Chr17:32687448..32687512 GCCAGACTGATGGATTGTGA Chr17:32687504..32687523 59.64 50
downstream ENSMUSE00000547278 Chr17:32687677..32687759 AGAGGGGACCTCTTCTGTGG Chr17:32687732..32687751 60.64 60
downstream ENSMUSE00000381239 Chr17:32688001..32688739 TCTATGGTGCCTCCCTATCG Chr17:32688433..32688452 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGACCCTGCATTTGTTG Chr17:32677321..32677341 60.55 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000048440