Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35753
Trapped Gene
AY512931 (ENSMUSG00000066158)
Vector Insertion
Chr 8: 46148534 - 46150364
Public Clones IST12565G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683867 (Chr8:46150279..46150363 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTGCTGGAGGAGACACAAT Chr8:46150314..46150333 61.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683867 (Chr8:46150279..46150363 -)
Downstram Exon
ENSMUSE00000683866 (Chr8:46148535..46148662 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTGCTGGAGGAGACACAAT Chr8:46150314..46150333 61.28 55 ACCAACGTAGTGGAGGATGG Chr8:46148582..46148601 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683868 Chr8:46150448..46150772 TTAGAACCGGGACCTGAATG Chr8:46150499..46150518 59.93 50
upstream ENSMUSE00000683867 Chr8:46150279..46150363 CGTGCTGGAGGAGACACAAT Chr8:46150314..46150333 61.28 55
upstream ENSMUSE00000683866 Chr8:46148535..46148662 CCATCCTCCACTACGTTGGT Chr8:46148604..46148623 59.84 55

*** Putative Vector Insertion (Chr 8: 46148534 - 46150364) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683865 Chr8:46148323..46148421 CTCACCACACGAACCACAAA Chr8:46148380..46148399 60.61 50
downstream ENSMUSE00000637094 Chr8:46146056..46147813 GCAAAGCAACACGTCTTTGA Chr8:46146217..46146236 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000066158