Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35755
Trapped Gene
Atad2b (ENSMUSG00000020631)
Vector Insertion
Chr 12: 5024949 - 5031387
Public Clones IST14879G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656176 (Chr12:5024931..5024948 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656176 (Chr12:5024931..5024948 +)
Downstram Exon
ENSMUSE00000490903 (Chr12:5031388..5031510 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656176 Chr12:5024931..5024948 No primer for this exon

*** Putative Vector Insertion (Chr 12: 5024949 - 5031387) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490903 Chr12:5031388..5031510 No primer for this exon
downstream ENSMUSE00000480788 Chr12:5033849..5033986 No primer for this exon
downstream ENSMUSE00000481912 Chr12:5038299..5038982 No primer for this exon
downstream ENSMUSE00000107246 Chr12:5040839..5040966 No primer for this exon
downstream ENSMUSE00000107253 Chr12:5041274..5041402 No primer for this exon
downstream ENSMUSE00000656175 Chr12:5050812..5054198 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCGACATTAAAGCCTCT Chr12:5027961..5027981 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAACAGCTTTTCCCTTTAGTTT Chr12:5027906..5027930 58.18 29.17 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020631