Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35761
Trapped Gene
Uhrf2 (ENSMUSG00000024817)
Vector Insertion
Chr 19: 30148494 - 30149573
Public Clones IST10358F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000255475 (Chr19:30148384..30148493 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGCCGAGTGATGTCTGT Chr19:30148406..30148425 58.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000255475 (Chr19:30148384..30148493 +)
Downstram Exon
ENSMUSE00000255426 (Chr19:30149574..30149760 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGCCGAGTGATGTCTGT Chr19:30148406..30148425 58.84 55 CCACACAGGTCACATTCAGG Chr19:30149607..30149626 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346551 Chr19:30105003..30105421 CGGTCTAAGAGCGTCAGTCC Chr19:30105104..30105123 60.01 60
upstream ENSMUSE00000692227 Chr19:30105079..30105379 CGGTCTAAGAGCGTCAGTCC Chr19:30105104..30105123 60.01 60
upstream ENSMUSE00000145220 Chr19:30113554..30113787 TTCAGCTGCTAGTTCGTCCA Chr19:30113606..30113625 59.74 50
upstream ENSMUSE00000255509 Chr19:30130725..30130984 CCTTGGTGCTTGGTTTGAAG Chr19:30130757..30130776 60.66 50
upstream ENSMUSE00000692225 Chr19:30130725..30131653 TGGCTTTAAGAGCGCAGATT Chr19:30131493..30131512 60.12 45
upstream ENSMUSE00000145216 Chr19:30145733..30145951 GATCTTCGACCACGAGCAAG Chr19:30145770..30145789 60.94 55
upstream ENSMUSE00000255475 Chr19:30148384..30148493 GACTGCCGAGTGATGTCTGT Chr19:30148406..30148425 58.84 55

*** Putative Vector Insertion (Chr 19: 30148494 - 30149573) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255426 Chr19:30149574..30149760 CCACACAGGTCACATTCAGG Chr19:30149607..30149626 60 55
downstream ENSMUSE00000145204 Chr19:30152504..30152627 TCCAGCCTTTACCACCTCAC Chr19:30152555..30152574 60.11 55
downstream ENSMUSE00000145234 Chr19:30153030..30153137 No primer for this exon
downstream ENSMUSE00000145247 Chr19:30154329..30154433 TCCAGCCAGGACAAGAGAAT Chr19:30154418..30154437 59.8 50
downstream ENSMUSE00000145212 Chr19:30157224..30157330 TAGTGTCTGGTCAGCCGATG Chr19:30157319..30157338 59.85 55
downstream ENSMUSE00000145238 Chr19:30160736..30160898 AATTCCGAGACTCTGCTCCA Chr19:30160800..30160819 59.95 50
downstream ENSMUSE00000145227 Chr19:30161666..30161806 CTCCTTGATCGTTCGATTCC Chr19:30161790..30161809 59.63 50
downstream ENSMUSE00000145200 Chr19:30162969..30163065 TTCCTTTTCCGAGGGGTAAC Chr19:30163001..30163020 60.29 50
downstream ENSMUSE00000145246 Chr19:30163676..30163833 ATGCCTTCAGCACTTTGGAG Chr19:30163714..30163733 60.4 50
downstream ENSMUSE00000145208 Chr19:30166531..30166629 GTTCTTGGCAGCACACACAC Chr19:30166585..30166604 60.37 55
downstream ENSMUSE00000545520 Chr19:30167208..30168210 AGACATGGTCCAGCTCTGCT Chr19:30167448..30167467 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr19:30148542..30148562 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTGGACTCTGTGTTGTGT Chr19:30148513..30148534 60.21 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024817