Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35769
Trapped Gene
OTTMUSG00000016580 (ENSMUSG00000078868)
Vector Insertion
Chr 2: 177101768 - 177102164
Public Clones IST14792B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678622 (Chr2:177102037..177102163 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTGCTGGATCCTTCTC Chr2:177102094..177102113 61.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678622 (Chr2:177102037..177102163 -)
Downstram Exon
ENSMUSE00000678620 (Chr2:177101769..177101829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTGCTGGATCCTTCTC Chr2:177102094..177102113 61.24 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711018 Chr2:177109010..177109073 TGTCCCAAGCTCAGAACTCC Chr2:177109017..177109036 60.39 55
upstream ENSMUSE00000678622 Chr2:177102037..177102163 GGCTTTGCTGGATCCTTCTC Chr2:177102094..177102113 61.24 55
upstream ENSMUSE00000678620 Chr2:177101769..177101829 No primer for this exon

*** Putative Vector Insertion (Chr 2: 177101768 - 177102164) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678615 Chr2:177099225..177100614 TCGGAGATGACTGCTTTGTG Chr2:177099419..177099438 59.98 50
downstream ENSMUSE00000678619 Chr2:177096237..177100614 TCGGAGATGACTGCTTTGTG Chr2:177099419..177099438 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:177102093..177102113 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078868