Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35786
Trapped Gene
Trpc6 (ENSMUSG00000031997)
Vector Insertion
Chr 9: 8626776 - 8634046
Public Clones IST14043H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215577 (Chr9:8626593..8626775 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAAGGATTTCGTTGTTGGT Chr9:8626621..8626640 59.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215577 (Chr9:8626593..8626775 +)
Downstram Exon
ENSMUSE00000215575 (Chr9:8634047..8634211 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAAGGATTTCGTTGTTGGT Chr9:8626621..8626640 59.98 45 GACAGGAGCTGTTGCTGACA Chr9:8634087..8634106 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400265 Chr9:8544142..8544598 GCAGAACCTAGCCAGTCAGG Chr9:8544278..8544297 60.01 60
upstream ENSMUSE00000502783 Chr9:8609700..8610474 GGTGCGGAAGATGCTAGAAG Chr9:8609868..8609887 59.98 55
upstream ENSMUSE00000215577 Chr9:8626593..8626775 GCAAGGATTTCGTTGTTGGT Chr9:8626621..8626640 59.98 45

*** Putative Vector Insertion (Chr 9: 8626776 - 8634046) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215575 Chr9:8634047..8634211 GACAGGAGCTGTTGCTGACA Chr9:8634087..8634106 60.19 55
downstream ENSMUSE00000215583 Chr9:8643506..8643722 TGGTGCCTTCAAATCTGTCA Chr9:8643620..8643639 60.24 45
downstream ENSMUSE00000215579 Chr9:8649298..8649531 ATGCCAGAACGCCATAAATC Chr9:8649440..8649459 59.93 45
downstream ENSMUSE00000539830 Chr9:8652936..8653200 CCACAGCGATTGCATAAAGA Chr9:8653004..8653023 59.83 45
downstream ENSMUSE00000301131 Chr9:8655177..8655372 GAACGTAGCCGATGTTTTCAA Chr9:8655288..8655308 60.12 42.86
downstream ENSMUSE00000215574 Chr9:8656542..8656745 CAAGATTGAAGGGGACAGGA Chr9:8656638..8656657 60.04 50
downstream ENSMUSE00000215573 Chr9:8658303..8658377 TGAAAGGTCTTCGTGACTTCC Chr9:8658355..8658375 59.32 47.62
downstream ENSMUSE00000215580 Chr9:8677924..8678007 No primer for this exon
downstream ENSMUSE00000215582 Chr9:8679468..8679543 ATCAATCTGGGCCTGCAATA Chr9:8679521..8679540 60.44 45
downstream ENSMUSE00000454306 Chr9:8680414..8680741 CCAGCTTTGGCTCTAACGAC Chr9:8680551..8680570 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCCCCTTTGTTACTTCA Chr9:8632791..8632811 59.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTGTGTGTGGATCGTGA Chr9:8626812..8626832 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031997