Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35791
Trapped Gene
RP23-303F24.3 (ENSMUSG00000081769)
Vector Insertion
Chr 11: 53627077 - 53663613
Public Clones IST10103A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711069 (Chr11:53663507..53663612 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGACAGCCAAGAAAGAA Chr11:53663555..53663574 60.52 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711069 (Chr11:53663507..53663612 -)
Downstram Exon
ENSMUSE00000721565 (Chr11:53627078..53627118 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGACAGCCAAGAAAGAA Chr11:53663555..53663574 60.52 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716999 Chr11:53672615..53672758 CGCTTTCGCTTTTGCTTTTA Chr11:53672734..53672753 60.61 40
upstream ENSMUSE00000711069 Chr11:53663507..53663612 GCTGGACAGCCAAGAAAGAA Chr11:53663555..53663574 60.52 50
upstream ENSMUSE00000721565 Chr11:53627078..53627118 GCCTCCAACGAGAACAGCTA Chr11:53627082..53627101 60.54 55

*** Putative Vector Insertion (Chr 11: 53627077 - 53663613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000712387 Chr11:53626463..53626826 TGAGATCACTGGCTCTGTGG Chr11:53626687..53626706 59.98 55
downstream ENSMUSE00000716699 Chr11:53622761..53623295 ATGTTTCTTGTCGGGGTCAG Chr11:53622968..53622987 59.97 50
downstream ENSMUSE00000716885 Chr11:53598991..53599851 TTCACAAAGTGGAAGCGATG Chr11:53599789..53599808 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCTGAGTTTCTGAGCACT Chr11:53627624..53627645 59.8 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCTGAGTTTCTGAGCACT Chr11:53627624..53627645 59.8 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000081769