Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35794
Trapped Gene
Ncr1 (ENSMUSG00000062524)
Vector Insertion
Chr 7: 4289969 - 4292361
Public Clones IST10103A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000198777 (Chr7:4289684..4289968 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTGAACATCTGGTGTCAG Chr7:4289744..4289763 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000198777 (Chr7:4289684..4289968 +)
Downstram Exon
ENSMUSE00000198780 (Chr7:4292362..4292640 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTGAACATCTGGTGTCAG Chr7:4289744..4289763 60.15 55 TGTGGTTGGATCCTCTCTCC Chr7:4292499..4292518 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000538673 Chr7:4289326..4289384 CACTGGTATGCTGCCAACAC Chr7:4289344..4289363 60.18 55
upstream ENSMUSE00000407516 Chr7:4289462..4289497 TCTGAGCCAGAGGATCAACA Chr7:4289469..4289488 59.5 50
upstream ENSMUSE00000198777 Chr7:4289684..4289968 CGGTGAACATCTGGTGTCAG Chr7:4289744..4289763 60.15 55

*** Putative Vector Insertion (Chr 7: 4289969 - 4292361) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000198780 Chr7:4292362..4292640 TGTGGTTGGATCCTCTCTCC Chr7:4292499..4292518 60.05 55
downstream ENSMUSE00000198779 Chr7:4292851..4292901 AGTAGGGTCGGTAGGTGCAA Chr7:4292894..4292913 59.62 55
downstream ENSMUSE00000198776 Chr7:4295740..4295787 TTGGTTGAAAGGTCAAACTCC Chr7:4295769..4295789 59.06 42.86
downstream ENSMUSE00000198778 Chr7:4296062..4296766 AGGATTATGCATGCCAGACC Chr7:4296128..4296147 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACCCCCTGAAACTGGTAG Chr7:4289944..4289964 59.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCCCCTGAAACTGGTAG Chr7:4289944..4289964 59.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062524