Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35803
Trapped Gene
Rgs7 (ENSMUSG00000026527)
Vector Insertion
Chr 1: 177083254 - 177119359
Public Clones IST14054E6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505410 (Chr1:177119308..177119358 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505410 (Chr1:177119308..177119358 -)
Downstram Exon
ENSMUSE00000686991 (Chr1:177083255..177083362 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TAGCGTTCCCAAATGGAGAG Chr1:177083314..177083333 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000500975 Chr1:177421184..177421261 TTATGGACAGACCAGCAACG Chr1:177421225..177421244 59.72 50
upstream ENSMUSE00000498969 Chr1:177200948..177201044 GCACGTATGCAAGACGAGAA Chr1:177201010..177201029 60.02 50
upstream ENSMUSE00000686997 Chr1:177200948..177201046 GCACGTATGCAAGACGAGAA Chr1:177201010..177201029 60.02 50
upstream ENSMUSE00000505410 Chr1:177119308..177119358 No primer for this exon
upstream ENSMUSE00000434784 Chr1:177083255..177083361 GCACCTTCTACCGGTTTCAA Chr1:177083255..177083274 60.11 50
upstream ENSMUSE00000686991 Chr1:177083255..177083362 GCACCTTCTACCGGTTTCAA Chr1:177083255..177083274 60.11 50

*** Putative Vector Insertion (Chr 1: 177083254 - 177119359) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434776 Chr1:177079783..177079834 AACAATTTGACGGCCAAAAA Chr1:177079785..177079804 60.33 35
downstream ENSMUSE00000434768 Chr1:177053062..177053126 CTAGCCTTGCCTTGTTTTGC Chr1:177053060..177053079 60.02 50
downstream ENSMUSE00000535194 Chr1:177052026..177052102 TGTGCTTCTGCTTGCATAAAA Chr1:177052010..177052030 59.64 38.1
downstream ENSMUSE00000434759 Chr1:177051859..177051940 GGACATCCCAGAATGCTCTC Chr1:177051848..177051867 59.62 55
downstream ENSMUSE00000323486 Chr1:177023935..177024009 TTCGTGTTTTGTGTGGGTTT Chr1:177023915..177023934 58.92 40
downstream ENSMUSE00000160233 Chr1:177021125..177021223 GGCTTGGTTTCTGGTGTAGG Chr1:177021131..177021150 59.59 55
downstream ENSMUSE00000160232 Chr1:177019550..177019611 No primer for this exon
downstream ENSMUSE00000160228 Chr1:177016247..177016357 GGCACAAGAAACGGGTCATA Chr1:177016285..177016304 60.89 50
downstream ENSMUSE00000658629 Chr1:177016247..177016311 CTGAGAGCCATGGATTGGAA Chr1:177016256..177016275 61.15 50
downstream ENSMUSE00000160231 Chr1:177014103..177014228 AAAACCCCATCGTTTTACCC Chr1:177014167..177014186 59.92 45
downstream ENSMUSE00000160225 Chr1:177009536..177009722 TCGGATAGGCCTTCTCTTCA Chr1:177009658..177009677 59.91 50
downstream ENSMUSE00000535186 Chr1:177008320..177008409 GGGGGTATGAGTCGCTCTTC Chr1:177008348..177008367 60.99 60
downstream ENSMUSE00000658628 Chr1:177006955..177007008 AGAGACGTTCTGCGATCCAT Chr1:177006955..177006974 59.83 50
downstream ENSMUSE00000658624 Chr1:177006148..177006228 GCATGGGAAAATAGGGAGGT Chr1:177006180..177006199 60.15 50
downstream ENSMUSE00000535184 Chr1:176996772..176996825 No primer for this exon
downstream ENSMUSE00000658627 Chr1:176996748..176996825 TTGAGGACAGGAGCTTGCTT Chr1:176996731..176996750 60.13 50
downstream ENSMUSE00000535185 Chr1:176989875..176989925 No primer for this exon
downstream ENSMUSE00000658626 Chr1:176989867..176989925 No primer for this exon
downstream ENSMUSE00000686995 Chr1:176989348..176989925 CAAGGGTGAAACGACACCTT Chr1:176989395..176989414 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGATCCTAATCGCCTTGCAG Chr1:177095294..177095315 60.72 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTGCAAATTTCTCTGCT Chr1:177095309..177095329 59.22 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026527