Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35809
Trapped Gene
9030224M15Rik (ENSMUSG00000045555)
Vector Insertion
Chr 10: 40466367 - 40530211
Public Clones IST13137G5 (tigm) IST14184A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393074 (Chr10:40466138..40466366 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGTTTTGATCCGAGTGTCA Chr10:40466198..40466217 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393074 (Chr10:40466138..40466366 +)
Downstram Exon
ENSMUSE00000342091 (Chr10:40530212..40530889 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGTTTTGATCCGAGTGTCA Chr10:40466198..40466217 60.24 45 AGGCTAAGAAGGCGAAGGTC Chr10:40530755..40530774 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337667 Chr10:40403088..40403470 CTACGGCTTTGCATGGAGTT Chr10:40403240..40403259 60.27 50
upstream ENSMUSE00000380786 Chr10:40449793..40449891 GGATGAAGAGGCCTCAAGGT Chr10:40449846..40449865 60.6 55
upstream ENSMUSE00000349828 Chr10:40457481..40457620 TGCCGCCTCTACTCTTTAGG Chr10:40457601..40457620 59.61 55
upstream ENSMUSE00000393074 Chr10:40466138..40466366 TCGTTTTGATCCGAGTGTCA Chr10:40466198..40466217 60.24 45

*** Putative Vector Insertion (Chr 10: 40466367 - 40530211) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342091 Chr10:40530212..40530889 AGGCTAAGAAGGCGAAGGTC Chr10:40530755..40530774 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTTGGGCACCACAAGGTA Chr10:40517351..40517371 60.23 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTGGGCACCACAAGGTA Chr10:40517351..40517371 60.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045555