Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35810
Trapped Gene
Gabra3 (ENSMUSG00000031343)
Vector Insertion
Chr X: 69678019 - 69690726
Public Clones IST14184A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208496 (ChrX:69690514..69690725 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGTCTGTTATGCCTTTG ChrX:69690612..69690631 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208496 (ChrX:69690514..69690725 -)
Downstram Exon
ENSMUSE00000520023 (ChrX:69678020..69680323 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGTCTGTTATGCCTTTG ChrX:69690612..69690631 60.27 50 TCCTTGGCCAGATTGATAGG ChrX:69680219..69680238 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699761 ChrX:69901994..69902073 AGCTCACACTTTGGTCCTGAA ChrX:69902023..69902043 59.9 47.62
upstream ENSMUSE00000382095 ChrX:69901346..69901493 CCAGGCTCTATCAGGGCTTA ChrX:69901397..69901416 59.43 55
upstream ENSMUSE00000341236 ChrX:69798016..69798190 GGGGAATCAAGACGACAAGA ChrX:69798049..69798068 60.05 50
upstream ENSMUSE00000699760 ChrX:69798016..69798198 GGGGAATCAAGACGACAAGA ChrX:69798049..69798068 60.05 50
upstream ENSMUSE00000517626 ChrX:69785402..69785523 GAATCTTGGATCGGCTTTTG ChrX:69785439..69785458 59.65 45
upstream ENSMUSE00000516614 ChrX:69756644..69756711 AGTTTTGGCCCTGTGTCAGA ChrX:69756654..69756673 60.69 50
upstream ENSMUSE00000552669 ChrX:69746418..69746638 ACCCAACAAGCTGCTCAGAC ChrX:69746452..69746471 60.45 55
upstream ENSMUSE00000552667 ChrX:69721565..69721647 CCCATGCATTTGGAAGATTT ChrX:69721606..69721625 59.76 40
upstream ENSMUSE00000208494 ChrX:69704928..69705071 CCATGTTGTTGGGACAGAGA ChrX:69704946..69704965 59.52 50
upstream ENSMUSE00000552665 ChrX:69696843..69696995 TCGTCATGACAACCCACTTT ChrX:69696967..69696986 58.98 45
upstream ENSMUSE00000208496 ChrX:69690514..69690725 AGCCGTCTGTTATGCCTTTG ChrX:69690612..69690631 60.27 50
upstream ENSMUSE00000520023 ChrX:69678020..69680323 CCTATCAATCTGGCCAAGGA ChrX:69680241..69680260 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCACACAGCATCTCTATTGC ChrX:69681726..69681747 58.89 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCACACAGCATCTCTATTGC ChrX:69681726..69681747 58.89 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031343