Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35820
Trapped Gene
Kif4 (ENSMUSG00000034311)
Vector Insertion
Chr X: 97834111 - 97860074
Public Clones IST13949E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360663 (ChrX:97834016..97834110 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCGCTGGATCAGAAAGAC ChrX:97834052..97834071 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360663 (ChrX:97834016..97834110 +)
Downstram Exon
ENSMUSE00000403610 (ChrX:97860075..97860191 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCGCTGGATCAGAAAGAC ChrX:97834052..97834071 59.95 55 AGCACAGAAGGCCTCGATTA ChrX:97860107..97860126 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345313 ChrX:97821076..97821927 GAAGGGGATTCCCGTAAGAG ChrX:97821822..97821841 59.9 55
upstream ENSMUSE00000290287 ChrX:97822043..97822157 No primer for this exon
upstream ENSMUSE00000290280 ChrX:97829178..97829368 ATGCAACTGTCCTGGCCTAT ChrX:97829184..97829203 59.58 50
upstream ENSMUSE00000349378 ChrX:97831023..97831115 AAATATCCGGGAGGACCCTA ChrX:97831082..97831101 59.62 50
upstream ENSMUSE00000389781 ChrX:97833623..97833789 TCCCAGTCATCTCGATCTCA ChrX:97833725..97833744 59.29 50
upstream ENSMUSE00000360663 ChrX:97834016..97834110 CCTCGCTGGATCAGAAAGAC ChrX:97834052..97834071 59.95 55

*** Putative Vector Insertion (Chr X: 97834111 - 97860074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000403610 ChrX:97860075..97860191 AGCACAGAAGGCCTCGATTA ChrX:97860107..97860126 59.98 50
downstream ENSMUSE00000352902 ChrX:97861012..97861187 TGTCAGCATAGCGAAGGGTA ChrX:97861113..97861132 59.44 50
downstream ENSMUSE00000290242 ChrX:97865248..97865309 TGGGCTTGTAGCAGCAAGAT ChrX:97865285..97865304 60.93 50
downstream ENSMUSE00000290232 ChrX:97872626..97872758 GCCTCACTCAGACCACGACT ChrX:97872721..97872740 60.47 60
downstream ENSMUSE00000290222 ChrX:97875185..97875243 ATGCCGCCTGAGTTCTTCTA ChrX:97875241..97875260 59.98 50
downstream ENSMUSE00000290214 ChrX:97875348..97875453 CCAATGTCTCCACGAGCTTT ChrX:97875388..97875407 60.26 50
downstream ENSMUSE00000290207 ChrX:97884397..97884453 CCCCTGCAGTATCAATGGTT ChrX:97884445..97884464 59.81 50
downstream ENSMUSE00000290200 ChrX:97885853..97886038 AACTGAATGGGCTGGAGTTG ChrX:97886031..97886050 60.11 50
downstream ENSMUSE00000290195 ChrX:97890210..97890313 TGGCATCCTTCTTTGCTGTT ChrX:97890306..97890325 60.78 45
downstream ENSMUSE00000290188 ChrX:97891337..97891481 ATCTCCTGGTTCAGCTTGGA ChrX:97891480..97891499 59.8 50
downstream ENSMUSE00000290181 ChrX:97892770..97892880 TGACGCATTAACTGGACTCG ChrX:97892807..97892826 59.86 50
downstream ENSMUSE00000290175 ChrX:97899381..97899464 No primer for this exon
downstream ENSMUSE00000290173 ChrX:97900129..97900242 TTCTGCAACCTCCTTTTGCT ChrX:97900191..97900210 59.99 45
downstream ENSMUSE00000290169 ChrX:97907131..97907286 AGAAGGCCATTCAGATGTCG ChrX:97907204..97907223 60.22 50
downstream ENSMUSE00000290164 ChrX:97907401..97907501 GCTCCAATTCGGTCTCTAGG ChrX:97907500..97907519 58.89 55
downstream ENSMUSE00000290161 ChrX:97909217..97909346 GCACATTTGGCTTCGAGAAT ChrX:97909327..97909346 60.22 45
downstream ENSMUSE00000290157 ChrX:97910920..97911090 TGTTGCTCCACTTTGACCAG ChrX:97911080..97911099 59.87 50
downstream ENSMUSE00000290151 ChrX:97911610..97911717 TCTGTCATCTGGGATTGCTG ChrX:97911656..97911675 59.79 50
downstream ENSMUSE00000290148 ChrX:97912670..97912747 TGCTTGATGGCACTGTTTTC ChrX:97912749..97912768 59.85 45
downstream ENSMUSE00000290141 ChrX:97913276..97913374 TCTGTTTGCTGGCTACTTGG ChrX:97913312..97913331 59.07 50
downstream ENSMUSE00000290133 ChrX:97913833..97914009 TTTGTTGGGATCCACTCCTC ChrX:97913978..97913997 59.9 50
downstream ENSMUSE00000290127 ChrX:97919981..97920097 CTGCATCCACATTGCTTGTT ChrX:97920027..97920046 59.72 45
downstream ENSMUSE00000290121 ChrX:97921467..97921589 TGCTACTGGGAGTTGCACAG ChrX:97921590..97921609 60.05 55
downstream ENSMUSE00000290115 ChrX:97921798..97922278 CACGGCAGACAGAAGAGACA ChrX:97922033..97922052 60.18 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCATCCTTAATCTGAACATTG ChrX:97855075..97855098 59.26 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTAGGGTGGCTGATCTGTA ChrX:97855119..97855140 59.21 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034311