Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35821
Trapped Gene
Med27 (ENSMUSG00000026799)
Vector Insertion
Chr 2: 29355847 - 29364942
Public Clones IST14868H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162919 (Chr2:29355739..29355846 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACGATTGTGAAGGGGTAT Chr2:29355797..29355816 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162919 (Chr2:29355739..29355846 +)
Downstram Exon
ENSMUSE00000162917 (Chr2:29364943..29364984 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACGATTGTGAAGGGGTAT Chr2:29355797..29355816 59.82 50 GGTAGCTGGATTTGGACCAT Chr2:29364973..29364992 58.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385559 Chr2:29202356..29202567 GCGTGAGTAGGGTCTTCGAC Chr2:29202444..29202463 59.87 60
upstream ENSMUSE00000162927 Chr2:29205366..29205510 ATCCTGTGCAGGACAAAACC Chr2:29205446..29205465 59.97 50
upstream ENSMUSE00000162923 Chr2:29268908..29269038 ACCATGCAGGTCTAGCGTCT Chr2:29268915..29268934 59.9 55
upstream ENSMUSE00000162915 Chr2:29326813..29326906 GGGACTTCAGCAATGCTTCT Chr2:29326886..29326905 59.43 50
upstream ENSMUSE00000697121 Chr2:29332853..29332906 CAGAGCATTACTGGCCCTTG Chr2:29332874..29332893 60.79 55
upstream ENSMUSE00000162919 Chr2:29355739..29355846 GCACGATTGTGAAGGGGTAT Chr2:29355797..29355816 59.82 50

*** Putative Vector Insertion (Chr 2: 29355847 - 29364942) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162917 Chr2:29364943..29364984 GGTAGCTGGATTTGGACCAT Chr2:29364973..29364992 58.86 50
downstream ENSMUSE00000162913 Chr2:29378294..29378371 ATGAAGGACCTGACCACGAC Chr2:29378373..29378392 59.97 55
downstream ENSMUSE00000360310 Chr2:29379887..29380308 TTCGGAAGTCTCTCCACGTC Chr2:29379989..29380008 60.39 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGATTTTAATCGCCTTGCAG Chr2:29355891..29355912 60.21 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTACACGTGACTGGGAAA Chr2:29355891..29355911 60.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026799